Description :
From Genome Similarity Track
Location :
scaffold_828:910- 3625
Sequence
2715 bases(100 bases per row)
TCGTAGAGTCGTACGTCTTCCTCTGACGCAAAGCTACGGCAGCCCCACTGCCCTTGGTAGTACTTGTAGTCAATCTCTCACCTGAGTTGGAGTATACTGT
TCCTGTGTGAGGATGGAGCAAGATACGTTTGCAAACCTCGCCTCCAGGCAACAAGAGGCGCTTAAAAATTGATGTCCTTGTTGGGCCCGGAGGGCGTGAC
GCATCTTGCATCACAAGGCCCGGACGCTATCAATGCGCGTCTCGAGGCTTTCTCAAGTTTTAAGGACGCTTTGTTGGAGTACATACAGCAGATGATGAGC
ACGGCGGCTCCTCCAATGGAAGCAGCCGTGTTGCAAGGGTCGACTCGACCGAAACCACTCATGGTAAGTTTACAGTCCTTCGAAGGAAAGGACGGAGGAA
ATTTCATGCTGTCGACCAGAGAGGTTGAAATGGCCATGAGTTCGGCCTTGCTCCAAACTTAGCGCCAGCGTGTAGCGCTTGCGATTGGAAAGCTCAGTGG
GCGAGCGTGTGAGTGGGCACTTACGAATGGGGCGTCAGTTGACGCTTCCTTCCCAACATGGGATGAGCTGAAGCGGCAGCTCTCACGAGTAGTGTATCCC
CCGAACCATGCGTATCGCGTGCGTTTACGCTTCCTGGTATGTCGTCAGGGCAAGTAGGAGTTGCTGAATTATGTCCAACAGCTTCGCACGCTCATTGATG
GCATGTTTGCCGATCCCCTGTCTGAGGCAGTGACCACCATGGCCTTTGTGGACGGTCTCTCCAGACCGGTGAGGCGTGCACGGAAGTCTTCCGTAGCCGT
CCAGCCTCGTTCGAGGAGGCTGTTGCCGTGGCGTTGAACGCCGAGCACAATTTCAAACCTGCCCGTAATCGGTTGGACTATTCCTCAGGCGGATGGACCG
GTCCCGATGGACCTCAACTATGCTGAAGGGGCTGAACTTCGAGCTGCTGAACAGCGCCGCGGTATCCGCCGCTGTTTCTCTTGCGGGAGCACCGACCATT
TGAGACCGACATTTCTGCTGCGCAAGCTCCATCCCGCTTCGAGTCAGAACACTGATTCGTCGCGGAGAAACGACGACTCCCAGTAGGCGTGAGGCCGCAT
GCTATGGATGAATTGAGTTCTGTTGTACCCTCAGAGATGTAGAGGTCAGCAGGTCTTGGCCCTGGAGAGATTCGTTATCCCTTGAAAGGATCGTGTATGC
AAGTCGGGATTGCTGGTCATTGAGGCGACCGCGAAGGGATTTGAGAAGCCGTGGATCGTGTTGATCGATTCAGGGCGTCGGGCAAATACGTCCGGCGCTC
CAATGTGGAAGGTAGTCAGCTGTATGTTGAAGCGCTACAAGCGCGTACTAGTGACGGAGTCACTGTCCGTCTAGCGATTGGAACCCGTGTTACGGTGCCC
AAGGTCCCATTGAATTTGGGCGTGAAGTTCTTAGACTTCGACAACACGAAACGCTGTTTGGTCTAGGTATGACCTCATACTTGGCATGGCGTGGCTGGAA
GACCACGAGTCATGGATCAACTGGAAGTCGAGAACATTAGGTGCTACGCAGTTTTCTCCTAACGGAGCTTTGGCGAGTCATGAACCCACCTCTGCTAGGA
CGCAGAAGCGCTATTGGCGCGAGTACTGGACCGGATCGATCTCCTGGACGTTGGTGTGCTCAAGTTAGACAACGCCAGTGTTGGGGACACTAGTCCCAAG
GGAGCGACGTTGACAACGCCTGCTGGTCCTGAGCGTGACTCGTTTGACGAACGTGAAGTGGCACGTAATCCACTATCAGATAAGCGACGCACCACCGCGT
GTCCAGGTGGACGCGGTCGGCGGCAAGCCGGCTGGAACGTAAGTGCTTTAGCATTTGGACAGGTTGGCGGTGATGTCGCCTTGTTGCCCTCCTCCACCCG
GTCTTAGGCAAGGAGGAGGAAAAGGAGGAGTCGTAGAGCATCTGTTGCGCGAAATGTCCAGCGTGTTGAGCGACAATGGTCCACGCGACTGTGGTGACCA
GTTGCACACACTCGTTAATGGAATATCGGGAGAAGTCGATGGCGACGTCAGCTTAGTGACATCCCAACTGTGGATGCTCTGTTTGAGCTAGACGAGATGT
CTGTAGCCGAGTTCGGCAATACCTTAAAGGCGGGCAAGTTAGCTGAATTGGTCATGATACGACCGGAAGAGGAGCTGAACTCGTCGTCACTGGTCGACGA
AGCGGTCCTGGAGGATACGAAGAAGGAGCTTAATGCGCGAAGTGGATCGGTAATCCTGAAAGATCCGTCGGATCCGTTCCACCCGTTGGTGGTGAGGTGT
GGAGACGTTGTCTCGAAGACTCTATCTATGGGTATCGAGGTGTTCGTCATGAGATTGACTTGGTTCCAGGTACCAAATACACGGCAGTGGCCTCTCCCGA
GGGAACAGTGTGACGTCATTGACGACTTTTTCCGTACGAAGCACGAGGCTGGGTTGGTGCGAGAGAGGAAATCTCCACACTCCACGTCCACGTTCGGTGT
CAGAAAGCTTAACGGCAAGTGGCGCATTGTGCATTCTTTCAATAAGCTGAATGCAGCCACTATCCCGGCACAGACGCCGATTCCTGGTAAGGATGTTCTC
CAGAACAACATTACAGGGTGTACGTCGTAACTTTGTTGATGGTTACTACTGATTGCTCATGCAAGCTAGTTACATCCCGCTTACAGCGGTTAGCACTCCG
AGCGGTGTGCTCTAG