Description :
From Genome Similarity Track
Location :
Scaffold_1137:91- 4093
Sequence
4002 bases(100 bases per row)
AGGCTGATCCACCATGGCGAAAGTTGAGTCCGTTTGGAGGTCCACCTCTGCGAGAGATTCGATTTCGGTACTCCCCTCGTACACCAGATTCTGCCAGTCT
TTGTAGCGGCGGGATCCCACTGACACCTATCTAGATAAAAAAAAGGATACCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAAA
ATCTTGTCGCTGACGTTCGTGACCTGGCGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGGGTGACCCACAGTCTTT
CATGTTCCGCCCACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATA
CAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCGGGCCGGCACCATGAAAATT
ATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGT
TCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGA
CACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTC
CAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGATCCAGTGAACAGACAGACCTTAGGTGGATCTGCAGTGA
CTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACAACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGA
TCTGGAAAACTCATCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTACGGTCCTGCTACCT
GGATCTGTCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTT
CTAGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCCTGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGA
ATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACGTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAG
TGTGCTTCCGGGATCCGCACTGCGAACACCTGACCTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATTCCC
CGATCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGGCGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATTCC
TATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGAGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCG
CCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCATCTGCGTCTGGAAGACGTAACAAGGTCAGCCTGTCGGCCAGATC
CACATCTCCCAACGTCTCGATGAAGTGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTT
AGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCAATCCACAGTACTGGGTCTGGAAGCTGCGCA
GCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGC
ATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCC
GATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGAT
CATCTGGGTCGAACTTATCATGGAAGTTGTCTCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGG
CGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGG
TCCACTGGCGAGACAGGGTCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGATGGATT
GTGTCAGATCACGCGTAGGGCCTACTGGACCCCGAGCCCTCACGTTCACAGGGGCTTCCTGTCTTCGGACCCCTCGCCCGCGCTTCCAGCATGGATGCCC
CGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGG
CGATGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCTGCGTCGCGGATGCTATGAGATCCAGATCTAGC
CCGAAGATATCCTCTGCGTCGAACACACCAGCTAGATGCCTGACTCAGTAAGCAAACGTAAGAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGT
TGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTTAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGA
TACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCA
TCTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTTGGTTTAGGTACGATGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCAC
TTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGGTAGAGAGGTTTCTCTTCTAGATCCGGA
TCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACG
CCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTA
GCGGGATCAACAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCGATGATCCGTGTTCTGCTGA
ACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACG
TGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGA
TCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCCTGCCTTTGTAGTTCCTTTAAGTCGTACTTGCCGCCTCCTGTGCCGGGATCTTGAGAGT
TG