Description :
From Genome Similarity Track
Location :
Scaffold_56:90998- 97121
Transcript NameFunction/comments
g17904.t1hypothetical protein
g17905.t1XP_009531434.1 hypothetical protein PHYSODRAFT_510625 [Phytophthora sojae
g17906.t1hypothetical protein

Sequence
6123 bases(100 bases per row)
TCGCCAGTCGTTCATTGCCTCTTGCTCCTTGATGTCCATTTTGCGCGTGCGTTTTGAGCTTTTCATTATGAGGTATAGCAAAAACTTGCTGCTGAAGATA
ATCCCAGGAATCGCGATTCCCATCGACAGCGTAAGCCAGCACAAAATGTTGCACTCGAAATCTTTGCATATGGTTCGGTCAGGTTCCAGGTCTGACGAAT
ACGGGCAATACAGACAAACCGTGGCACCGTCTTCCTCTGAATATGCACGGGCAGAAACTTGACTGCATGATACACAACTCCCCGTCGAGTTGTCGTGATA
AGTACCGGCAACACACTGAATACAGCCGTAGAGACTCACAGTGGTTGTTGACCCTGACACAGAAGAAGATGACAGATCGAGCTCCTCAAAGACACTGCCG
TTTGGACAATCATTGCGCATGTCCACATTTGAGGACCAGCCGATGCCAGGGTTGTCCAGTAACGTGCTGTCAACCAACAACATACAATTAGGGACAACAG
TACGTGAGTCTTAGTTCGGCGCTACACTTCAATACCACGTCGTCCTTACACATTCGTGAGCAACTTTTTCACCAGGTATACGAAGTTCGTACTGGGAATG
GACGTGATAAGGTTCGAGTCGAAATTCCTAACACCCATAGACGTCAGAAGAACTAGCTTTGACTGCAACGCTAGCAAGTCAGTGCAACTACGTACATTGA
TTCGATCGTCGACATGATTGGGTCGAACACAGCGGAGCTGAAGTTGACGATACGATTGTTACTCAGGTCTCTACACACAATGGAATCGGTTAGAGAGCAG
GAATTCACAACGGTGAGAGTGTAGTGCCCACTGGAATGAAAACATACAATGTCTCGAGTCCGGTATATGGCGTTAGTGCGTCATTCGTTGCGATAGACCA
CAAGAAGTTACGGCTCATGTTCCTACAATAATTTGTCGTTAGCAGCAAAACCAAAAACAATATTTTTCAAAAGAGGAACCATCTAGTTTTCACGTACAGG
TATATCATCCGCGACGCCACAAAGTCGTCCGGAAAGTCAGGCATGAGGTCCAACAGGTTGTACTGGAGCTCTAGCCGTTCCAAGTTGGCAGGAACAGACG
ACAATGTCAACCGGTGAATATTATTGTAATCTAGTCTGAGGTCCTCAAGCCCGTTCACGTCTTTGAATGCATCTTCGTCGATAACGGAGATGACATTGTC
GCTCAGATTCCTAATCAAAGATTGTATCGGCGCGTTAGAACCCAGCCATACAAACTAAACCAAAGCAAGACCCATGATGTGAAACGCACAGTTTTCTAAG
CGCTTCCATTCCAGAAAATGCTCTGGAGTTGAGAGTAAAAATCGCGTTGGATGCTAACCGAAGTTCACGGATTTCCGAGGCGTCAGCGAAGGCTCCTTCA
TCAATCTCAACGAAAGAGTTGTAGTCGAAGGAGCTGTAACCATAGTCGAGTTAGTTGATTACACATTCCAATTGACAGGAACCACACAGATTAATGCACT
CGTACATGTAGCCTTCAACGATAGCTTTCCGGATACCAGACGGCACACGTAGGATGCCATTGTGTGAGAAATCCAGTGCTTTCCACGAAGCAGACGCCGT
CAACAGCCCATTAGGCACGACCTCAAGTTCATTGTAGCTCAGGTCCAACGTATGTAGCGCCGTCAAATTCACAAACGAGTCTCCGTAAATCAGTGATACG
TTGTTCTGTGCCAGGTCGCTATGAAAAAAAGCTTGTCAGCCTCAGATGACAAACCCAGCGAAGAAAAAACACGTACATAGACTGAAGCTTCGGCAAGTTC
ACCAGTGCCTGTGACTCAACCGTCCGGATCGTGCTCTGATTGAACGCCATCACACTCAACAGTGGACAATTGCTGGCAAGACCTGTGGGCAGCTCTTGAA
TCTGCGTGTTTGTACAACTACACACAACCAACTCGTCAGCAATGCTACAACGAGCTTATAAACCACTAAAACATCAACTCGATACATACACGACTCTCGT
AAGGTATGGCATGTTGACGAACGACTCTGCCTCCAGCTGCGTCAAAGGGTTGTTCGAGATATCTCTGCTCCCAACAAAATACTCAAACGTCAGCTCTTTC
AGCTCTCTAAAAACAAAACCACAGGCATTTTCACTGACATGTACGTGGAATTGTTGGCCACCTGGAAGAGCGCGGCTGGAACGCTGGTCAGCGAGTTGTT
CTGGAGCAGAATAGTCGATTCCTTCGCCAGGTCCAAGGCTGACAGCTCCGTTACGAGGCTGCCGTCACTGTAGAACGCAAACGAGGCGCTCGGCCCGCTC
CCAGCAGTTGTGATGTTGCTCAACTGACGCGCCGAGAGCTCCAAACTGCAGCGACAGACAGCAAGTAAAAAATTCAAATTCGGCGATGACAACGTTAAAT
CCGCGTTGCAGCTCCAATACACGGCTATTCAAGACGGAATAGGCTGCAATGGATAGCCAAGACGATGCTGAACAAGATGCAGCATTGCTACGTACGATAC
GACGCGCTGTGCCGCCAGAACCACCGCTGCAAGTTGGAGAGTCCAGAGATGCCTCATAGTGCCGCTTTTATCGAACTGAGCATCAAGTGTAGTAGTGTAA
ATTATGAGCTTTATGCATGTTGATTTTGCAAATATGGACTTGAAGCTTATTGCTGGTACACTGTACCATGCCATGACATTGATGAGCACTGTTGTTCAAA
CGCCATTTGGTTCCAAGACCAGAGGCGCCATGTTCCTCCAGCCGCGCCAGACGCAGACAGAGCTCCATGGATACTCGGTACGCAATCTGCGGCGAATTAG
CTGCGAGCTCATGCAATTTTTACGCGGCGAATCGCACGAATTCTCACGGAAATCGCTGTCGTATCAGGTGGAGTTCAGTCCGTTCGTGGACAACTTGGTG
GCGATCGGCACGGCGCAATACTTCGGGATTGTAGGCAACGGGCGGCAGCATGTGTATGAAATGCTCCCGGCGGGAGGTTTGGCTCCGGTGAGACGCGTTC
GTCGCGCGTTTTACGGTTGAAAAAAAGCGAGTTGCTTACGTTGTGGCGTGGAATCAGGTTCGAGCGTTCGATACGCCACAGGGAGTCTACGACTGCGCGT
GGAGCGAGAACCATGGCCAACAGCTGGTGAGCTCCTGTGCTGATGGGTCGGTGAAGCTGTGGCACTTGCAGACGCGCGACCAGTTCCCGATCCAGAGCTA
CCACGAGCACAAGCAGGAGGTGTCCGGGGTGAACTGGAATCTCGTCTCCAAAGACTCGTTCGCGTCCGCATCGTGGGACGGCAGCGTGAAGATCTGGAAG
CCTGACGTGCCGCACTCCATCTTGACACTTGCAGAGCATTCGAGTGCCGTGTACAATGCAGTGTGGAATACGCAGAACAACTCGCTGGTCGCGTCGTGCT
CGGGTGATGGCTGTGTGAAAATTTGGGACCTCAACAGCGCGCGTTCCGTCACGACAATTGCTGCACATGGTAACGAGGTGCTGAGTCTGGACTGGAACAA
GTACAACCAATTCGAAGTCGTCTCTGGATCGGCGGACTGCATGATCAAAGTTTGGGTACGTAGTTGCCAGGTAGCACTCGTCGAAGCGAACTTACATTTA
TTTTATTATTACAGGACATCCGAAACCCGGGACGCGAGGTGCGGATGCTTCCGGGACACAGCTACGCCGTCAAGAAGATCAAGTGCTCACCCCATGACCC
AGACGTGATCGCGTCGGCGTCCTACGACATGTCGGTGGGGATCTGGAACACCAAGTCGCCGTATCCGCGACTTCAGAACGCGCAACACCACAGCGAATTC
GTGTTCGGCTTTGACTTTAGTCTCTTTGTGGACGGTCTGGTAGCCTCGTGCTCCTGGGACCGGCAGGTGGCCGTTTGGAACTACTTCGGTGGGCCGCCGC
CATCGCCGCCGCGCTAAGTTCGCACTAGCGCTAACCCCTCATAATCGATTCCTTACCACCTATCAGACCCAACGTTACCGGCATGGAGGCGCCCAAGAAG
ACGGGCTTCTGGACGCAGCATGTGGACCCGAGCAGCGGGGTAAGTGTCTAAACTGTTCCTTTAGACACCGCTGCTGCTGTCTACGGCTTGGTTTTGCTTT
AGCGTGCTAATTCATGGCGTTATTCGCTGCTGACGATCTGTAGCGGGCGTACTATTTCAACATGACACTGGGACGGAGCTACTGGGAGCTTCCAGCCGAG
TTGGAGGCCCAAGTAAAGAAACCAACGCTGGATGCGCTGCGTGAATGGGATCCAGAGGCTGCAGAACGCAAATACGGAGCTGCTACCCAGCAAGCAGTCG
GGGACGACGAGATCCGTCGAAAGCGGGAGGAGGCACTAGCCAAGTCCCGGGCGGAGGGTGAAGCTCAAGCTGCGTCCACGAAGGTGTCTCTGGACGAGAG
GATGGCCTTGGCAGCTCAGAAGAGGAAGGCGACAGAGGTGCAGAGCAGTAATGGAGGCAGTCGGTTGCCTTCCTCCAACAACGCCGAGAGCTCCAACGAG
TACCTGGCACTCGTGCGTCAACTACAGCAGCATGATGACGGAGAGGAAGGAGCAGGCGGCAAATGGCTTGTGAGGTAGAGGAGAAAATAGGCAAATGAAA
GCAATAGTTTATTCGTGAGCGTTCGCCGCGATGCTTAGCCGCTCGTCTTCCCTCTCTACCGAGTCAAGAAATCCTCGTTGCGTGCCGCTTCTGCAATGAA
AACAAGCAAATGAAGTATCAGCATCAATTACCCTAACATAGAGGTTTGCAGTATTGATAAAGACGCGATGGCGCACTCGCTTGTAGGCCTGGTACCGGTC
CTGGAAGGAAATGGACTTTTCGTCGTGCGCCGACGGCTTCTTGGGTTTTAAGTCGAAGAGCTCCTGCACGAACGGCATCTTGGCCAGCACGCACTTCCAC
ACGACGAGCCAGCTGATGGTCAGCGTGAAGAGGACGATGCATACGGCGCCAGACACGTACGCGCCCGTCACCACCAGCTCCTCCAGCTCCATGACACCCA
AGTTGTCGCTAGTGGCCTTCTTCTGAAATGCGAACTTAACCCTTGCTTAATACGACTAAGTACGCACGAGGGTGAAGTGTCAAGTGCTAAGGTGAATTGA
TACGATGTTTCTCTATTTATTGCATGGAAGACTACTTGGACTATTGCTTCCCCAAACTAAAAGCCAAAAGTGACGATGAGTCCTGCAGCAGGACTCGTGC
TACTTGCTGTTTGATCCCAGCAAGCCCATCGTTCATAGTGTACGAGGGGCAGTGCACTTCAAGGAAATGCACTTGTATCGCCTGGACTGCTTGAACGTGT
TGATTGTGAATCGAGCAGAGCGACTTCAAAACAGGAGGCGGCGTCGCGGCTGAGAGCGTGATCCCCCGGGCCTCGAGCGGAAGTACAGTGACGCCCGCCG
GCAGCTCCACTGCAGCGTACGTGCACTCCTGGAGCGTGCACGTATCACCTGAATACTTGTCTGGGCCTGCTCCTCCACCACTCGTCGTCTCTTGTTCAGC
ATTTGCTGTTCGTGCGCTCTTTGCTGCTCTCGCTCCAGCTCCCGCTTGGTCTTGCGAAACACCAGCGGCTTGGCAAGTGGTTTAGCCGAAGGAGCAGCAC
GTGGAGCTTCCTGCACTTCAATTAACCGCCGTCTCGGGCTGCGCACTCGGGGCATCTCGCTGATCAACCGCGCGCAGATCTCCTGGTGCTCTATCGTCGC
CAACGTGCTGTGCAGTGCCCGACTGTGCAGCAATAATCCCGTCATAGAGTTCCACGCCCTCCGTGGCGCTACTTTCGAGCTCCTCTGGCCTGCCATAACT
TCGCGATCGATCGTCGTAACTGTAGCAATTGAGCAAGCGTCAGGTTAAAGTGATACCAAAGTGGAATCGCAACAGCAATGCTGCAATTGTGTTACCTGTT
CGGCTTGTTAATTGTAATGCAAGGCACGGTCAATCGCAGCGACAGGATCGGAAGCTGCAGCTCGAGGGCTCGTGACCTCGAGATGAAAGTTTCAACTCTG
TTGACACTTTGGCGATTATCCTAGGTTCGGTTCGGATGTTTGAATTCAAAAACCGCGAGCTTCATCCCTGGTGTACACTACACTATATATATTAAGTATC
ACACACCATACAGAACTTAAGCC