Description :
From Genome Similarity Track
Location :
Scaffold_953:9096- 11584
Transcript NameFunction/comments
g16619.t1hypothetical protein

Sequence
2488 bases(100 bases per row)
TATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGA
GGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTAT
ACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCGTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTT
GGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAAATGTGGCCGCAGTACGAGGCGACAAAATAGAGCTGCGACGCCCCAC
ATGATGCGCTCATCGTAGCTCGTGTCTTCACAAATATGCCGGCCGAAAAGCAGTTTAGACGCTGCAAGTTCCGAGACCGTATTCTGCTGAGCTGGCACTG
CGGTGTTAGATCCAGAGCGGCCAACCCATCGAGACAAGTGCTGTCCACTGTGCCGCTAGGTCATCCCGACCTACGGTTGTTTTGTAGTCTAATGGGGCAG
ATGGCAACTGCGCGGTTGATCCAGTCTGTAACAACCGCAAGAAGTTGACACCGTTGTCGTCCGCCACGGCAACAAGTGTCCTCGCTTCGTCGACGACCAG
AACAATCGGTTGAGTTCCTTGCCCGTGCCACCATGACCAGTAGTCGGTAGGTCCTTGGCGATGGCTGCTTTAACGCGTGCATCCGCGTCTGGGTGAGTAA
ACAACTCTATCCACTCGCTACCCACGGTCTTCCAGCGATACTGAGCAAAGCTGAAAGCTCTGGGAAGTTGATACGTCAGATACTCCTCGGTCATCCCGCC
GAAGAAAACTCAGTCAATCTCTCTGCTGCCATCTTGTTCTTCCGAGCACAAAAGTAGAGAATGCGCATGGTAACTTGATTTTTCTCGCCAAATATTCCCA
AGCATCGTTCGTCTTGGTCATGTTGGCGACCTCGTACAGCAATCGGCTCTTGTCAAAGGCCGATCTCTCCACTACAGCTCCGTAGAGCCAAAGCCTAACA
TTTCGGGAACGGACTAGCCAACACGCACTAACAACAATTGTAAGAACAGCATTAAGCTAAGATCCTGTGGAGGAACTGTTTCTCGGTTCCTCGATCCGAA
TACACACTCGTGGTCACTGTCGACGTTGTGTATCCTCCGACTAAACCTTCCCCAGTTTACTTGGGTTCCTGGTGCACCGCCGTTCAATAGCCATAGTCGA
GTCGATAACCTCAGCATGACTCGAGTTCAGCGGTGGTCCAAAAACACGAGCGGAGCGCCAACGTTTTGAGCGTTGGGTCTCTCTCAGAGATGAAGCGCTT
GACCTCCTTCGCTTGAAAGCGATTCATAGTTTAGACAGATACGATGCATTGTGTGTTTCTGCGAGGTGAGTACAGACAACGACGGATTTAGCCGGCACCA
CTGAGTGCCATCCGCCATACTAAAGTAGTGTGACGGAAAACCCGGCATGGATTCAGCGGGCATGCAGTAATGACAAAAACAATACACTTTTCTACATAAA
TCGATGCAAAAGTGGTGGTTGTATCAGAGACTAATCTCAGGATAGCGTGGAATAGCTTTCTCAAAGCTACGAATTACCGTCTCTTTAGAAATCGCGTCAA
AGGCAGCAATAGTTGCGCGAACTGCACGGATGCGCTTTTCCTTCGCAGTGCCGCCTGTGATGCCGCTCCAGTTGGTTCGCATCTTCGCCTTAAGCGGCCC
CATGACGCCCACGTCAAGGGGCTGGCATGATGCCGTGCTGTTAGGAGGAAGAGGAACCACAAGGGCGTTAGCAACTTCAGTGACGACCCGCTGTCCTTCT
TCAGAAACGTGACACTCAAAGTTGTCTAGGATGAGGACAGCGGGTCCGTCCACTTCGTACTTGAGCAATCTTTCAACGTAGAAACGCCAGCAAGCAGCGT
CCATCCAGGCGCTTTCTTGGACGGTGTAAAAGTGACCTTCCGGGTAGTCGTCAAACTCGGTGGCTTCAATGCGGCCACCCGGTTTTCCTCGTGCGATAAA
CAGAATCGGCAGCTTTTTTCCTAACAAATTGCAAGTAAACACTCATTTAGTACAGTGCATGGCTGGAAAAATACCAATAGCTGCTCGAAAGCTTACCGTC
CGCCCGAACTGTGAGCACTGCCGTCATACGGCCTGCGTGTTTGGACGCGTTGGCAATCCTCGCAGGATCTCGCCGTCCTCTGCCCGCCCAAATCCTTGCG
GGGGGCATGTCAAAGTTGATGGCTGTTTCATCAACATTGAGCATGCCCCCGGGACCGTACGCTTCATACTTTCCCCAGAACTCGATCGCAAACTCTGCGC
GTGTCTGCTCGAGGTCCGCAGTGCTTTTCTTGGCAGTCTGGGGTTTCTGGGGTGTAAATCCATGTCTAAATACATCATTTTCATACAA