Description :
From Genome Similarity Track
Location :
Scaffold_270:9093- 17542
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_270-snap-gene-0.9Conserved gene of unknown function
Pytve_DAOMBR484snap_masked-pve_contig_270-abinit-gene-0.35Lipase domain protein
Pytve_DAOMBR484snap_masked-pve_contig_270-abinit-gene-0.29Conserved gene of unknown function

Sequence
8449 bases(100 bases per row)
GGCGCTGAGAACTCGGCGAGCGCCAGGAAGGCGCTAGCGAGGGCACAACGAGTGCTGCAGGTCGTGACGGCGAAGCGGAGCGCGCTGGCGCTGCGCGACG
TACGCGAAGTCCTGGAGGTACAGCACAGACAGTAGCGTTCACATTACCGCCAGAAAGAGGACGCAGATCAGCTAAAATGCTCTGGTTTATAGGAATGTCT
CAAGACGGAGGCGAGCTCGCTGATGAAAGTGATCGGGTACCGCATCCTCGCCAAGCAGCCGACCTGTTTGGACCACGACGCGTGGAACTTCGTGCTCGAG
TCGTGCGTGATGGAGCTGGCCGGTTCCCAGAACGCGCCAGTGTTGACATTGTCGATCCCGATATTGGAGCAAATCCCGCTGCCGCTCGTACTGGGGTTCC
TCGTGTCGACGGAGAAGGAGCCGATGAACAAGCTGCGAGCGATTCTCTCCCACGAAGACATCGATGTGCGCTGCTGCGCGATCGGCACTCTGTCCAGGAT
CACGCTGGAGATCGCCGCCAGCATCACGAACGGCGGGCTGATGGTGTTCCCGTTCGAGTCGCACGAGGCTCGTATTTGCTGTCAGCAGGATGTGTGGACC
ATGGTCGTCGACGTGTGGAAGATCATCTTCCAAACGCTGCTTCTCTCTGACGTACACTTGCAAGACGCGGTCGGCGCAGCATTTGCTGCAATGAGAATGC
TGTTCGCGAGGACATCCGCCATGGCGCATTTCTTCTCACTTACAAAGACGCATTCTCGAAACCAGGCGGCGATGAACGACATCGCATCAGCGCTATACAG
GGATGCCTACCCACTCGCACGTACACTCATCGATGCTGTGCACAAGCTGCCGATGAAGTATCAGGCGACTGGAGCGGTGTGGATCGCCACGTTGCTCTAC
ATGATGATGGAGCGGACGGGAGCTCGTTGTCCGAGCGTCAGTGTGCCGTACCTGTCTCTCGATGTGGTGAATGCTGGTTCCGATAACCTCGATCAAGACG
AAAGCGACACATCATCAACGGAGAGAGTCCGAATCGACCAGCTCGTTGCAGAACAGCTCGAGTCCTGGATGATCCCGCTGTTGTCAAGCAAGACATCGCT
CTCGCAAAGCTCCAGCATTTGTCGTGCCATTTTCATCTTGCTGTCTCATCCGATGCAGGAGTTTAGTCGCCTGCCGCATAGCGCAACCCTGGTGAATCAC
ATGACTGCGCAGTGTGCGTTCAGCAGGAACAGCGCGACCAAGTTGGAATTTGCCCAAATGCTGGTGCGAGCATTTTCGTGGCTGTCGAGCGCGGGGTGGC
TAGTATGGTTCACGCGAACAGTCGACGCTGTCTTTCTGGTGGACCGTGAAGCGTACGTGAATGTGCACATTTTGCTGTTGTTTCATATTTCGTCGCTGTG
TAACTGATATTGGATTCTTCGTGGTATCGATGCAGCGATCGAAACGGACTTCTTAGCACGTTGATGGCTGTGATTGTAGAGCGTGTCCGGAAACACCGCG
ATTTCCAGCTTTTGGAGTCGATTTGCGCGATCGAGAGTCTCACTCAAGGTGGACTCAAGCTCACTCAAGGCATGGTGCTCGCCGATGTCTTCCGCGCTCT
CGTGCAAGCCGCTGTCAATCGTGAAGATCGAGAATCGATCGACAACACCCAGGCTGCGTTTGGCGCTCAGCTGATTATCTTGAAAGTGTTCAAAGCTGCT
CTCACACCAAAGAGCCCGGCCGCTTCGAGTGACCTTGAGTCCCTAGAGTTCAAAAACAAGAGCAGTATGCTGCGCAACTATATGACGCTGATGACGGCAC
ACTTCCTACAAGGAGCAGAGAACTCGGTGCCAGCATTCCAAGAATCGCTTGATTACTTCCGCAACGACTGCCTCAAGATTTGGCGCCAGATCCCGTCACT
CCGAGCTCGACTCCAGCTTCTCTCGATCGGGATCTATTTGGTGCAAGAGTATCAGCTTGTTCCTCCCCAGCTTGTGCTGGATGCAATCAAGTACGAAGTC
GCTGCGACATTCACGGTGTCTTCGGATCAAGACAGCGGCGGCGGCGGCGGCGGCGGCGGTGGAACCCACGCGACTGTGACGATGACCGCGTTCGACGATG
GGAAACTCGGCAGCGGATCAACAACCGGCGGCGCTGTACTGGACTTTGTCGCTGGTCAGGAGCGATGGACGAATGTTGACGCTGTAACAGCGATCGTGGA
GTGCTTGAAGCACATGGCTCGCATCTATCCGCCAGCCACCTCGCAACTGGCGCCGATATTCCAACAAATGCACGTCTACGCAACTCGAAGCTGTCCAGTG
ATCCTGCCATATCACCACATGTACGCCAACGTTGTTGTGGGACGGCTATTCATACACGCATCAGTTCCTAACTACCATTTCTGACCTGCATAGACTGGAA
CAGCAGCTGCAGACTAGCACGGACGTCACGAAGGGATTCTTCACCCAGTCCATCATGAACCCATACTCTGCGTTGCATCCAGAAATGGAGAAGTGGAACT
CGCACACGGAACCGACTGAGAGTTGGAGATCTGTCAAGACAATCACAGGCAGTGGTGATCCGCTTGCCATCCAGTTCGCGTATTACCAGCCGTTGGACGC
TAGTCTCGATGTTGTCGTGCTGCAGATCACGTGCAGCAACTTGACAAGCCTCTCACTCAACGATTTCGAGCTGCGGGTCTGTCCGATTGGAGATACCGCC
AAGTCAGTCGACATCGTGAATGATTTCAAAGCGCGTGTATTGCAAGCGGGCGGCTCAGCGAGCTCCAACTTGCTTCCGTTTGGTACCGTCCGAGTCGAGA
AGCGTTTTCAACTGTGCAAGTTTACGCAGGCGTCGTTCCTTGTCCAAGTTGCGTTCATGGAAGCCGAGTCGTCAGAACAGCCGTCCACAGAGCAAGTTCC
ATTGCAGCTCGCCGTCTCCGACCACTTTACGGTCTCTTTCGACGCACTCTTATTGCAACCAGTCTCGCAATATGCGACCGCATCGTTCTTCCAATGCCAA
TGGCAGAGGTAAGTGCGAGCTCCCAAACAAGGTTTGGATTGTGAGCTGTTGTGAACTCACGGTGGTACCTTTGTAGCGCTGAAGCAGCCATGGTGCTCCC
GGTTCGCTCGACAGGACGCACAGATCCCCCCACAACCTCGTCGGAGGCGCTGTCATTCTGTCAGTGCGTGATCAAACGGCAAAGTATCCGTGTGGCCGTT
GTTGCCGAGCTGCTGGTTGACCTACCGTTCTTCTTCCATGTAAGACCCGTACTAGTTTTGCAGGATGGACTTTCGGACGGGTTTCCAACTGTCCACTATA
CTCGCTTTGCGCTAGGTGGCGATCCTGAGCAAGTCGCGTTGGGATGACTTCGTCGCGATCTCACTCACGCTTACCCAATCCAGTGGCAAGTGGTCAGGGT
CCATGGAGGTTCGTTCGACCGCCGCCAACACTCGCGAACTGGAGAAGTTCCCGACTGACGTCCTGGAGCTCTTCGGTGGCGGATACTTTGAGCGACTCGG
TTCGAACCCAACGGACATGTCTGCAATATCTGACGCGGCGGTCTCGGGAGCTCACACTGGTGCATTCGAGCACGACAAGGCTGCACCCGCCAGCGCCTTC
TCGTTCGCTCCCGACTTCCCGGTGGAAACTAGACAGCCCCAGAGCGTCGGTGCCGTAGACGCGTGGGCGGCGATCCAGTCCCAGTCGCAGTTGCCGACAG
CGGTCGGCGGCTTCAACGACACATGGGGTTGAGGCAAAGTCCGAATCGTGCCCTTTCGTGGCTCCTGCATTTGCCAAATTTTAAATCAGATATTTTGCAT
TTGAGAGCTCCAGCCAATCAGCGAGCATAAAACGACCCGATTCTTAGTCCGAGAAATCGCGATTTTGCGTTGCAGTATCCTGCAGAGAACATTTCCGGCC
GACCGTTCTCGATCCATGTGGCGCCGGTCGGACGACTCGGCGGACAATGCCGGCAGGCCGCCGCGGCGCCAGCGCCATGAAAGCGCGCGACTGCCGACGG
ACGAGCCTCCAGAGGAAGCACAGCGCGTGTACCGGCCGCTGCTGTTCCAGTCCAAGGGCTACGCGTCGTCCGAGCTCTTCCGCGACACGTACGAGATGCG
GGAGCGGATGCAGGCAACCGACGCGCGCGGAGACCCGAGCGTCGCGCCGCTGCTACCTGCGAGTGGCGGTGCAGGTGTGGAGAGACAGCTACAGAAGGGA
GTCGGCGCCGGTCGGCCGCGGATCCGACTGGAGACGCTCTCGTCCCGCGCCGCGACCACCGTGTTGACGATCACGTACCTGTCGTTCGTGCTGGCGCTCG
CGGTGCCGTACCTGCAGAGCCAAGGCTACCTCGAGACGGTTGGGACTACTGCATCGCTTGGGAACATGATACTCGGTGGGAGATCTTGACGGGGTTGATG
TATGAAACAGGACATTCGTCTTCCTGGGGGACTGTGTGCCAATCGGACGCGTCCACACGAACCGTGTATCTTAGTGGATCCCGAAAAGGGCACCGCACGC
TGGTCGGCGTATGTCGGTAATGTGTCCTGGTTTGCAGGCTCCATCTCTGTGAAGCTCGAGGTCGCCCAAATGGCGAATCAGAGCGAAGAGCGCGTATTCA
ACGAGTCGAAACGGCTGGAATTCATTGGCAAAACCTGGACGCTGCCGGGCACAGCGGTCAACTTGGATAATAGTGAGACCGCCGACAGTGACAACAGCAC
GAACCTGCGCTCGACCGACTACGACGAGGCGCAGGATGAAGGCTACATACTGCGGTATGGCTATGAGCTGTTCGGTATCGACACGAACGTGATGCCGTAC
GACAAGGTTCGCATCGCAGCCGAAAGCAACCAGAGCGTGTGGGTCACGTGCCACGCGCGAGAAGAAGGGTGCGACCAGGTGAAACTGTTTGAGATCTCGC
AAGATTTCGAAGGACTGGTGAGCTTGCACTTTTCAACTGCTGGTGTCACATTAGCAGCTGGACTAACTGGTCGCGGTGGTGTGCTATACGATGGCAAAGC
GTGGTAATGGGTACGGCTCGTACCTCGTCGCTGTGACGTTCCATGGGTTATACCCGAATGTGTTCGGGCGTCAAGTGCAGTACGAGTTCGCGTACACGTA
CGTGGCAGCATGAAATGGTACCCTCATTCCTCGGGTCACCCTAACGTGCCTGTGATCTGCTTTTCGATTCAGCAAGCCGGCCGTTCACGTGAGCGAGGTC
GTCGTGCGCTGCGTGTTCCTGTTGTCTTCTATTCTCGCTCTCCCCTGCTGGCTGATCGCCGTGCTCAACTTCCACGATGGCTCGTGGGTGAACGTCTTGA
CACTGCAGAAGTGGGTGCTCGGTCTTGGCGTGGTGCTGATCCTGTGGCAGAATCCAGTCTACGCTGCCACGGAGATCTCTCGAGCTGTCAGCTTGCGCAC
GCGGTTCGTGTCGATGACGTGCGAATCGTTTGCAGAAGCGTTCTTCTACGTGTTTTGGCTCAATTTGCTGGATCAGCACACCGGCGACAGCGCGCTGATG
CAGCACAGTGCGTTCTGCTCGAAAGCGTTGCTTGGTCTGAGCATGTTCGGAGTTGACACGGGCATGACAGTGCTGCGCATGCCCAAGTTATTTTCCGGCA
GCGAGGCTGTGTATCTGTCGTTGGTGCGGCAGGACGACGTGTACGTGCTGCTAGGTTTTCTCCGGATCGGGCTTCTTCTGGTTTGGCTGGTATGGATTGT
GGTGATTGGCGTTCGCACGGGGAAACACCTGCGAGCTTTGCCTTACATGGCGACTCGATTCAAGCAGCTCTCGTATCGCTTCCTGTTTCTCGAGACGCTA
TTGATTATTGTCTACGTTCTGGTGTTGTCGGCGCTGCAAGTGTTCTATTTATTCCAGACGTGGTACCTGATGGGCTACGACGCATTCATCCAAGACGCAG
TGCATACGTTCGCGAAGCTCCACTCGGGCCATCCGTCGTTGGGCCAGTTCATTTTCTTATCGGTTTACGTCTACTTGGTCATGTTTGTGCATTTGCCGCC
GCGTAGTGGCGACAATATGGGACTTTTCGCCTCTACCGCCTACCACGTCGAAGAGCGTCCGCGACTAGACTCGTACGGGTTCCTCACTCCCGACTCGAAC
CTCTTTTGCGTGGAGACCGCACAGTGGCTGTTGGAGATTGCGTGGCAGGCGTACTTCGATCCGCCCGGCAAGCCGTCGGCGTCCGGATACGGCGAGTTGA
ACCTGGAACGCTACGGCTTCGACCTGATTACGCACCTGCGGAGCAGTTTGACGGACACTCACGTCATCGTCGCGCTGAGTCAAGGCGATCACTCGCGACT
CGTGATCGCGTTTCGCGGCACAACCAGCAAGCAGAACTGGAAGAGCAACCTGCGTGCAGATCAACGGGTGTTGTGGATCAAATCGCGCGGGTTACGACGC
CGAAAGACGTGTATGGAAACCACCAAGGATATTGCAGCCCGCGTTCCGATCTTGAACATGACGCTGCCACGAGTCCATCGAGGTATGCGCGCTTGGTGTT
CGTGGTTTGTAACATATGGTCGCTTGACGCTGATCGTGCACTCTTAGGCTTTTGGGTCGCCTACGAGTCAGTGCGCAGCGAGCTGAGAGAAGTGGTGCGC
CTCATTTTGGATGAAAATCCTGGCGTGTCGGTGTACCTCACCGGACACAGCATGGGCGGCGCTCTCTCGGTTCTTGGGGCATACGACCTTGCTGTCAACT
TCAACATGAGGGTCAACATGTATAGCTTTGGCGGGCCGCGTGTTGGCAACCCCAGCTTCCGCCACTTGTACGACAAGTGCGTACCGACTAGCTACCGCGT
CGTCATGGACGGCGATATCGTTCCCGGGGTTCCGAAATTCGTAAGTCGCGCCAGATCGTTGAGTGGGTACACCTGCTGTGGAATGATGTGGCCTAACTCT
GCTGATACCGATGCTGTAGTGGGGTCTGTACCAGCACGTTGGCACGGAGATTGCTCTCGATGTCGAAGGCAATTTGATCGTGGACCCGAGCTTCGTCGAG
CGCCACCTGCACGCTTCGTCCAAGCGAAAGCTCACCATGCACGGCACGAATGTGTACCGCGTGTCGCTCGCAAAATGTATGGAGAACTTAGCTTAGGTTT
TTTCACATTCATGCAAGCATACATTGCTCGTTCAAACTATTTTCGTTGGTGTGCTGCTGCCTCGTTGCGGGAAATGCACTGCTAGTTTCACCGCACAAAG
GGAAACGGACAGTCGATTTGCGGACCCTTCGTATTTCGAGTATCGTTCAGTCAAGGATCGATCGGAAGCATGGACGAGCAGGAAGACCAGCAGTATCAGC
GCGACGGTGTCATTCGCTCTCATATGGAATTCGCTGAGGCTGCAGCGAACGGGTCACGTGCCATGGTACCGTGTCACTCGCTCTTGTTTCGCTTGAGGAG
GGACGCATTTGCGCTCACTTCGGCTTTGCTTCCTTTTGCACAGGTTGAGTTTTTGTTGGATAACGGTGTTCACATCGATACTCCGGGCAAAGGTGCTCTG
CCAATTGCAAAGCCTGCTGCAGTGGACAGGGTCGTCGATTGTGACTCTATTCATGGTGTTTTGCCTCAAAGACGGCACGACGCCACTTTGTGCGGCAGCA
CTCTGGGGAAACGACGCGATGGTCAGCTTCCTGCTCGACAAGGGTGCCAACGTCGGCGCTCGCAACGAAGGTTGCATCCACTTGTGATATGATGGGATTG
CTTCCTCGAGTGCGACGACACTGAGCAGATTGTCGTGATTATAGGCACCGGTTGGACGGCTCTGCACGCTGCAGCCTTCCAAGAGCACGGGAAGGTTGTT
CGCGTCCTGCTGGACCATGGCGCAGATCCACGCGCCGCCGATGTTGAACGTCGCTCCCCCGCCGACTACGCTAGCATCTCGGAGGCTATCTGGCCATTCT
TTGCAGGTAAGCAAGCCAGATCTACCGCGAGCATTAGTTCAAAATGGTAACGTTCTGGCGACTATCGTCATCGTTTGCAAGCGCGGGGATGTCAACGGAG
TGGCAAAACAGATCTCGTGGCGAAAGGCATCATTCGAAAAATCGTGGACCAGCCCGAGCAGACGGCGAGCTTTGACAAGATCGACGACACGGTAGGATGT
CATTGCACACATATCAGGACTGCTGGAGTATTCATGAGCTCGATATGCGGTGTGACCGCCTCCAGCTATCGGCGTTCTCAAGGCCAGGGTCGGCGTACAT
TCGCGCTCAATTTCAGCCGCCAAGCGCGCAGCGTCTTGGCACCGGAACCAAGGTGAATACCATCGGTGGTTTTTTGTGTATACCGTGCTCAAGTTCATTC
ATGCCTTCATGGTTCCTGTGCATTTTGCAGACTCGAGAAGGACGAGGTTCAATATCAGGGCCAGTTGATCCGCTCGCTGTGCCCGACCGTTCTGATGCCA
ATCGAACAACAAATCAGCGCCGACCATCGTTCCAGGGCCTCGCATTGTA