Description :
From Genome Similarity Track
Location :
Scaffold_424:9092- 13157
Sequence
4065 bases(100 bases per row)
CGGCAATCGCAGACATGCGAATACGCTGCGCAGAAAAACCTTCTCCTGCCTGTTATGGCCTCTGTGGTAGCCAAGTGGGGTCGTCGAAGGCCGTCGATAT
CGAGATCGTCAGTGTCGAATGCGTTGCCGCGGCTGTCATACGAGTCAGCTGATTCCATGTCGGTGTCCGGCATACACGCCCCGAACACATTGTGGTTGGG
GGTAGGGCGACCGGTTGGCACGATACGGGGCGGTTGACGGTGTTGGTCCTGTTAGAAACTTTTCCATGGCTTTTGCAAAGTAGATTTGCAACTAGTCGGA
TTTATCCGTAGCAGGGACTTGCGTAGTGGTTGAATCCATCGCCCTGGTGGTTGGTGCCGTATGCTCGTGGTGGTCACGCAAAAATGCTGATCCGGAAGGT
CCCAACAACATTCGTTTGATCTCCATGTCATCGATTTCCTCTGCATCCGACTCCGCAGAGGCGTAATGCGACGACACAGCCAAGGGATGTTCTTTCTCTT
TGAATTTGACGGTGGTCGTGAGTTCTTGATCAGCGGAGTCATAATTATCGGCCAGTGGGACCAGCGCTTTGAACAGTGATCGGATGGCCGTGATCACCTG
ATCCAGGTCGCAGTCAAGCAAAACCTTCGCATCGAACGCCCCCGGTTTAAATCCTGCGCCTTGTAGTATTCTAATGATATGTTGTCCCGCTTCCATTTTG
CTTGTGGCAGCTTGTGGTGCTATTGTAGGTCCTTGGATCGGTCCAATCAGCTCCGGTTCCAAGATCGTGAGTACTGGATCTGTTAATAGCAAAGTTTGCA
GCTGGGTCCATGGTAAACGACGTTGTAGCTGATCCATCTTTCAACATTCCATCTTGATCTCTGCTGCCCCGCTCGTTTCCTGATTGTCACCCTCGGAGTC
AGGTGCTCGTATCTTTTGAGCCGTAGCGTTCGGTCTATTTTCTTTGTATATAGTTTTCTTTTTAGACAAAACATATCATGCTTTGGCTGGACGTGTTCCA
TCTAGCGGGTCGTACTTTGCAGTACGACCCGCGGTGGTCCCTGAAGGGACCTCAGGAGATAATAGAGGTTTTTCTTCGAGATCACCTGATTGATCTTCCT
CCTTAATTTTCGGTTCACCCGAGCGCCTCCAAAACTCTGACGACCCGAGGATCCTTGATGATCAGGTGTATGAGACAATCCCTTCTTCGCCGACACTTCC
ATCTCCGGTTCAACCTTGACCTTTCCATCTTCGCTCTGGGATTCAAGGTGAAATCCCGAGTCAACAGAAAATCCGGGCACGCGGACCATTGCGGTGGAGT
GGGATTCATTCATTTTATGAAGCGATCCCAACTCTCTACTTGCGCCCGGACGACCGATCAACGGAGGGGGTACTCCGAACCGTGTGTCTTGTCTTGTTCC
TTCTCACCTTGTGTACCCGTCGGCGAGCGGGTTGCACTCTTCTATGTGGCTTGAGTTCGATGTGTGTACTGACCGAGTTGGGGATAGGTGGGGTGTAGTC
GCGTGGGAATTCTTCACACGACCAAGAGTTACTTGTGGAGCTCTTCCAGAGTCGCCCTGACTTTCCTTGAGGTCGCCTTGCCCAAATGTGGATACTTGAT
CCCCTCGTTCTTCTGACCACTTGAGCCGTCCGAAGACCTTGCCTTTATATGCTTTCCGCGTCCGATAGCAGGCCAACTTGAGTGAGTATCTTCGTCACTA
GCCAAGAAACCTAGGGACAAACCTTGAGCAAACACATGAAGCAGTAAACCGTGAACGTCGGGTGGTCACAAGTATTCCATTTCGGAGGGATGCTGACGTG
AGTCTTTTGTATGAAAATTAATACTGTTCGCTATTGACTATTAGGAGCTAGAAATACGCTTAAACTTCTCTATATCTCAGTTTGTTACGTCATTCACCCC
CCGCCACCCATTCCCTGTGCATGAAGTGACCCACCTCAACTGCCAACATGACCGTTGGTAATCCATAGTGACCATGACCGCTGGTCATCCATAGTGACTA
TGACCACTAGTCGCCAACCGTGCCATAACCGCTGGTCACCGTATGTGAATGCGACTGATGACTTGTCAACTTTCCACCGTACCGTTGAAGATTTCTAGCG
GTCAGTACCAAGGCCGGCGTGACTAGTCCCACATGTACCCATAATGTGAAATGCGATTGGTCAGGATTTCTCCCGACCACTTTATCACAATGACCCTTCG
CATATTTTCGGGTGCATCACAGGACTTTTCAAATCTAGCGGCTCTGAAAAGGAGACCGATAATATATGAGACGATTTACCGAGATGGCAAGCGTGAAGAA
ACGACCGTTCGTCCAGTAGACGTTACGCTAGTGAAATCAGAGAGAGTTTACGTTGAGCTCGCCTTCAGTTTCAGTGACTTCTCGTGCAAAGAGAATTTCA
CAGTGCGAGGCATGGAGAGTCCGTATGACCTCATCCTAGGCATACCTTGGTTGATAAAAAACAACCACCGATAGACTGGCGAACACGCACAGTCGCTAGA
TCTACGCAAGACACCGGAAAGGATGTGCTCTTGCGAGAGGATAATGTAACTAATGCTGTGTTTAATGTAGTTAAGGGTTCTTTGACAGTGATTCACACGT
CACCAAGGACTAATCAACTCGATGGCAGAAACCGGCACAGATCCAAGGAACTGGTGCGGTTGTAAGGAATACGTTAGCTACAACAGCAACAATACCTGAT
TCCAAGCCAAAGAATGTCGTGATGCGACGTGTGACGCGTACCAGACGAATTGTAAAGACGATCATAGGCGCGTCAAAAGGAGTGACCTTTGGATCAGTCT
CGGTCCAAGAGGACGGACCTACGAACGAAATGTTCAAGGCCGTAGAAGACAAGATGCCGGAAGCATCCTAGACGGAGGTTCTCCAGCATGTCTTGGGATC
TGCCGAAGATAGTTAATATCTCGGAGATGACGTGGGATCTGTTCCTGTCCGAAATTAAGGAAGGAAAGATCCACGAGATAGTCGCACCAGTTCCAATGGA
GAACTTGGTGGACTGCTGCTCTTCGTCCACCATGGACGAGAGCGTCTTGGAGACCGACAAGACAACCTGATTTGCTGCTAAAGGCTGGGACGACTTGAAA
AGCAGCCCGTTTTACGAAGTTCTGTGGAAGCACCGTGGTGTCTTTCCTACAGAAGTGCTGAACCGCCTACCGGCCGATAGGAAAATCTGACACGAAATTG
ACTTGGAACCTGACACCAAGTATTGTGTGCCAGGCAGTGGCCATTGCCTAAGAAACAGGTCAACTGCATCGACCACTTTATCAACAAGAGAGCCAAGACG
CGACATGTACTGAGAGCGAATCACCTCACTGGAGTCCGAACTGTTATGTGCGTAAGGCAACAGGTGGTTGGAGCGTAGTTCATGCTTACAATAAGTTTAA
CACGGCCACCATTCCTGCACAAACACCGATCCCGCGAAAAGATGTCCTATTGAACTTAATGGAGAAGTCAACTATATTTTCCGCGTTAGATTTGAAGGAT
GGCGACTATCAGGTACTCATGAATGAGACCGATGTAGCTAAGAAATCAGCTAGCACTCCAAGCGGTATGCTGCGGGAGTGGCTAGTGATGCCGCAAGGGT
TGAAAAACGCACCTACGACATTCAACGGGGTGGTCCCTCATGTGATGCGTCCACACCGTGCCTACGCGCCTCATTACTTTGATGATATATTCGTTCATAG
TAGGGACGAGGATGGATTGAGTGAGATAGAATTGTACAAACGTCATTTGGACGTTGTGCTGAAGACTCTGGGCGACGCCCAATTGTACGCTAGCTTGCAA
AAGTACGTCATAGGTGTCCCCAAAATACCTGTACTGGGCTGCATCGTAAGAAAACACGGTGTTAGAGCAGACCCAGAAAAAATTAAAGCTATTAAGAAAT
GGCTGGTCCCACGACATGTGAAGGATATGCGTCAATTCCTTGGGCGTGCTAATTGCTTGCACAAATACGGCAAGAATTATGCAAACCAAACCAAACCAAT
GTCTGACCTCCTGAAAAAGGATGCAGAATGGACTTCCTCTGAGGCTCGAGTAGATGCTTTCACTT