Description :
From Genome Similarity Track
Location :
Scaffold_287:9092- 10685
Transcript NameFunction/comments
Phyag_g4327hypothetical protein

Sequence
1593 bases(100 bases per row)
ATTATACCACTTCAGCCACAGCGTTTGGATCTTGAGAGCGGCCATGTGTTGTTCGTGCTGAATACGCTCACGCTCCATTTTGCGATGGTGTTGTCGTGCT
CCCCAGTTCCGCTGAATTTTCACTGAGCTTGCATTTTGTGTTTGCTTGACGCTTTCGATCTCTTGCTTCTCTCCACGCCTTTTTTTCTCCTTGCGCCAAA
ACGCTTGGATTTTCAATGCATTCGCAACGTactcctgctgcagacgttCATCTTCTTTCTGTAAGCTCTGCTCtttctccagcttcaccCGTTCCTCTTC
CCTCAGGCGTCGAACCTTTCGCCACCAGGTTTGAATGACAAGCACAGCTGCAGTCCTGTGCTCTTTCCGTGATCTGGATCGTTTTCCTTCTTGGACGCGA
TGCCACCGACGCCACTTCCGCTGAATTCGTTGGGCTCCAAGACCCTGTTTACGTTGAATCTCTTCCTTGTCTCGGCGAACACGTTGCTTTGTCCAATTCT
GCTGCATCCTTAGCGCGATCGCACGTTGCTCTTTTTCCTCACGTTCTCGTTCTGCCCGCTCAAGTAATCGCTGTCTCCATTGTCTCCACGCTCTTTGAAT
CCGTTTCACAGCGCGAATCGCTTTTCTCTCCTTTAACTTCCGCAGCCACCACTGACAACAAGCAATTTGGATCCTCGCCGAGTTCAACTGTCGTCTACGC
CGCTTTCTTGCCTTCTCTTTCTCGTACTTCCGTTTACACTGCCACTGACGCCAACTCTGTTGAATGCGTATGGCTGCCAGTATCTGCGTGTTTCGTACAC
GATCTGCTtctctcttctccttctgccACTTCTCCCAGCATCTTTGTATTATCTTGGCACTGTGATTTCGCCTTGCCTCTCGTCGTTTTCTTTCTCTTTT
CGCTAgttgccatcgccaccaactcTGTATTCGGAGAACACTTACACGCCTTCGCTCTTGCAGTTCTTGCTTGCATTTGACACACGTTCTCCACGCTCGT
TGAATTTTACGCACGTTGGCTCGAGTACGAATAACTTCCAGCCGCGCCTCAAATGCTAGTTTTTGTTCGTGTCTTCGATCTCGCTCGTGTTGGACCCATT
TCCTCCATGCACTTTGGATTTTACGAGCGTTCACCCGTAGACGTATCGCTTCGAGCTGTTCTGCAAAAGCAATTTGTTGCAGAAGTTTTCGCTGCCGCTC
GTGTTGaatccagcgtcgccatgcTCCTTGAATTTTTCGCGCATGAGCTCGAACGCGGATTGCTGCAAGCCGTTCTTCAAaaagctgttgttgctgttgt
cttTGCTCTTGGTCGCGTTTCACCCACTGCCTCCAAACTCCCTGAATCTTGCGTGCATTTGCTCGCCGTCTTACCGCGTCTAACTTAGCATTAAATACAA
GCTGCTTCttttgccgctgctgttctcgtcgctgctgctgcttgtgggcACACTTTCTCCACCAAAGTTGTAGTCTTCGCGCTAAATCGTGACGCCATTT
AGCTTCTTCTAGATAGGCACGTGTTAGCTCCTGTGCACGCTTGCAATTCTGGTCATGTATCCATTGGCACCAACCTCGTTGAATCTTCCGAGC