Description :
From Genome Similarity Track
Location :
Scaffold_103:909- 3269
Sequence
2360 bases(100 bases per row)
TGGATTGATCTCTGATGATCTTCTGGTTCCGACCCACTAAGGTCGGATTCAGATTCAGTGCAACTGTATTCAGCTCGTATCATTCTCACTGCACGCGCGG
TCTTGGAAGGTGCCAGAACTGTCGTTGCTTTCTGCCGATACTTGGACGATCCCATCATTGCTTTCCCGTGGCGCGATCTCCCCCGTTGATAATCCCGCAG
TGTCACTTCCATGGATTCTGCGCCTTCTACATGTAAAAGCAGTAGTTGACCGGCTAGATTTTTATCGTCCAGAGTATCGATGAAATGGTCCACGTCTTCC
TTACACGAAGCTGGCGATCCTGTCTTCACTGGTATCTTCGCCTGCATTCCGATCACGTTGAGACGGTACAGGTATTCGAGAGGCGTTTCGTCAGGTCGTT
TCTTCGCGTGGTAGTACTGTCGGCCCAACGATACTCCGTGTCCAGCGTACCCCATCAAGATATTATCCATCAGAGCCTTCCACTTGAATCGTGTCGATCT
GCTCAGCTGACGATACCAGTAACGGGCCGGACCTACCAACAGGTCGCCAAAAACCAGACACTTATCTTCTTTTTGGTGCTTGATCTCGGAGGAATGCTGA
TTTAACCTTACCGATCCAACTTCAGGCTCGATCTTCATCCGGATCTTTGCCTGAGAATTCCTTCAACTCCGAGATCGCTGAGACTCTGATCCTCTGCGTG
GTAACATTTTACTTGTATCGCCGATCGTAGCCACTTGCAGTTTCCTTAGTTCCGGGATCCATAAATCGTCCGGGTCATATTCTGCTCTCTGCAGAAATGG
CTCCGACACAACCGATTCCATGTCTACATCTGGCACATCGCGACCTTCAGGCTGAGGCGGGGGAACTCTGCCTCGATCTATGTGCTGTTTCATCTCCTTA
TCCGCTTGCCGTTCATCTAGGAATTTTTCCATTGCAGCGTTGAAAGTTTTGTCCAAAGCGTTCTGCTCATCCCTGTTTGATCTGGCCCTCGCCGGTGCAC
GCGGTGTTTGTACCTCGGTCTTGAGATACCCGTGTGTCGGCTCGATATTGACTCTGTCCATCCGATCTCTTAAGAAGGATCCTCTTAATGGTCCTCGAGA
AATCCGTCGGATGCTGATTGATTCTTCCGAGTCGATCTCAGAATACGCGGAAGCACCGCGACGAATCTGATTGAGGCTCTTGGGCCCTATCGTACGGTGG
CGCGATCTTGGCTTCGGGCGTGGATACCTTGCCTACGAGGGAAATTATAATCCTGAAAAATTCGTCCACAGCACTCTGGAATTGATTCATGGTGCATTTC
ATTAGATCTTTTGCTTCAAACGCCCCTGGGCAAAACCCCGTTTCCCACAACATCCGTATGATCAGATTAACCACGTCAATCTGACCGGTTACCGGTCCTG
GAATTGTGATCGGTTTACCTAGTGATCCAATCGGCTTTGGTTACGGATCGTGAACACCGGGTCTGTTCTAGCAGCATCTTCAGCTGGCTGTAGTTGTAGT
TCCATTCTACACTATCCCACCTTTTCCCCACTGTCTCGATCTTTTGGGCTGCGTCTGGTGCGGGTTCATACTTGACTTTTGGTACCGCGATCTCGGCCAG
TTCGCGGTCGTATTCTTCTTTGACCACGCCTTTCGATCTGGGAGGTTTGTTGATACGCTGATCTCCGTCCTCCGATCCTGGTGCTTTCATTTTCGTTCCC
GATCCCGCGGGTTGCTTGGCTGTCTTCTTCATCTTAACTCCAGGTGATGTCTCAACGAAGGCATAGGGTTTGGCTTTCGCCATTGGATTTTCATCGATCA
GATCGTTCTTTGCAGAACGACCTGCGGTGGTCCCCGAAGGGACCTCGAGAGGGAGTTGAGGTTTTTCTTCCAGATCGATATCTCGATCTTCTTCTTTCAA
TCTCTTAACATTAGAATCCCTCCCAAATTCTGACGATCTGGGAATCTTGTATTTCTACGTGTCTGCGCCGATCCCTCTGTCGCTGACACTTCAATCACAG
TTTCTTGCTTGATCTTGACATCTTCGCCAGTGGACTCACGGTGAAATCCAAAGGCCTCAGAAGATCCGGGCACGCGCACCATTGCGGTGAGGTCGATCTT
ATAAAACTGCTGATGTGAGTGTCGATCTTCCACTTGCCCAGACTTGCCGACTTACGGAGGGGGTACTCTGATCCGTGCCTTGAAGTATAGTCTTGTGCTC
ACGTTGTGTACCCGTTGGTTGGGCTGGATTGAGCTCTTCGTAACGGCCTTGGGAGATGTCGGTCTCGTTGTGAGTTCGGGATCGAGGTTTGACCACTGTG
CAGAAAATCTTCACACAGCGATCGGGGTAGTCTTGCGTCAATGTTCTTGTTAGATCGGTC