Description :
From Genome Similarity Track
Location :
Scaffold_2526:909- 2883
Sequence
1974 bases(100 bases per row)
AGAGTATCTTCGACTCCTCGGATGAAGAGGAGGAGAAGGAAGAAGAGGAGGAGGAGGGTGCTATCGTTGAGCCCCGGGAGGTCTCGAATGACCTCGACCA
GCAGCAGGAGGATTTCCAAGCTGCTCAGCGTGTGCGTGGGGGTTCGGTGTCGGCACCCGTCAGCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCT
CCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTTGAGGTTCTCGTCGTTCCTCGTGGCCCTGTGGGCGGCCACACTTCTAGGGGCATCTATGAACGAGCCC
TTGCTCAGAAAGAACAGTTATTCGTTGACAACTTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACTACGCATTCCCCTTAAGGACTTCACGACCTGTCG
TAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTCTTTGGGGATACCCCTGAGTTATGCCCGAGAACTGTCCCACGTGGAGTTCTTGTGAGGACATGTTC
TGGGCATGGGTGGGGACTCTTAAGTACTCACTCACGGAGTTACGGGAACTCCATGAAGATCAGCTGCTGTCCCGCATCCTGGACCAGCGTGATCTTTGTG
TGAGGTTTGCCCACTTGATCAGCAAGCGCATGCTGCCATGGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGAATGTATTC
CTCGTCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTATCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGA
GCCGTTCAATCGGCTCCCACGAGATCTCGGAGTGGGCATAACCCCTTCATTTCACGAGGAGCTGTCGCTTACCGCGACGCCGTTGCTCCTGGAGGATCCG
CTCCACGTGGATGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGGCACCTCCCGAGCGACACTCTCGTCC
GAGCGCTCCGGCTGCGGTTCCGACACAGGGGCCCTGCGGTTGACCGCCTCCGTCAACGTGTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGG
TGAATGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGACGACAGCGCTGACAGTGTCAAGGTGTAGGTTCCTTGTGTCTAGTAACACTAAGTCCCCCAC
TTTAAATACACTTAAGTTTCCTCTTCCATGTTTGTCGGAGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAACGCTCAGCTTGGTATC
CATAAACGATTCCACCTGTTTCCGCAGCGAAGCTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAG
TCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCGTGAGCCCCGTGGACGCGTGCACCGCGTTGTTGAGCG
CAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTCTG
GCCGTCTGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTATCCAAAACGCAGCAGTGAACCGCGGGTCTCAG
TCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAGGGAACTTGCGGTTTGTTCGCCCGTAACAGACGGTGACAGGAGCGAGA
TGTTCAAGAGGGGAGAAGTCGTTCGTACCCATCGCACCTAGCTTCAGAAAGGTTCAAGTTGTCGAAACGCGCGAAGAGCCATTGACGGCAAGTCATACCG
GCTCCAACGGCGCAACCCACCCGCAGACGCTAAAGAATACCAGCGGATCAGGGGGTTCGAACAATTTCTCAGCG