Description :
From Genome Similarity Track
Location :
Scaffold_569:909- 2028
Sequence
1119 bases(100 bases per row)
CGACTGGAACGCCCATTCGAGAGTCGAGTAGCGGGTATAAACATGGATGGTCTTCCCGGCGAGCAACGTGTGGCACACCTTGATGAGCTGTAGCAAGGCG
AGAACTTCTTTCTCGGCGGGATGGTAGCCGAGTTCATTATCCTTGAGGACTCGGCCGCAGAACCGCACTGGATGGAGCTTCCCGTCGTGGAGCTGCATCA
GCGTGCTACTCAGAGCCCACTCATTGGCGAATAGCATAACGTGGACGTCCTCAGCCGAGTTGAAGTGGCGGAGTATGGGTGCGTCGACCACCTGCTGTTT
TAACTCGGCGAACGCCGCTTTTGCGGCCGTCAGATCACCGCCGGGTCCGAAATCTTCGTCCTTCAGCTGATAGAGGACCGCCCCATATACAGCCAGGTTC
TGGATGAACCGGCCGTAGTAGTTCAGCGCTCCTAAGAATGCTTGCATCCCCTTCTTCGTCGTCGGGAACGGTAGCCCGGCTATGGCCAGCATCTTTTTCT
GGTCGGCTTGGATTCCAGCCGAGGTCACCCCATGTGACAGGAAGTCGACTTTAGGTTGGACGAAGATGCTTTTCAGGAAGCTGACGCTGATGCGGCATTC
GGTGAAGCGTTGCAGCAATCGGTCAAGCGTCCCCAACCAATCGTCGAACGTCCTCCTACCGAAGAAGATATCGTCCACAAACGATCGCCGGTCGAAAACC
GGTGCAAGGTACGATTCATCAGGTTCACCCGTCCGGAACATGTCGGCTTCTGGGCTGTTAATGAATTCTTCCAATGGGTCAAACTCAGCTTGAGCTCGGC
GGTCGGCCTCAAACTTGGTCTGGCCACTGGCTTCAAAGTCGATGTCGGCTGCGAGCCGTTTCCGCTGAGCTTCTGAGGCGGCTTCCGCTTGTTGGATGCG
CTTGGCGAACACATTCCAGCCGCCCTTGGGTTGTACGTAACCCCACAGAGCGTTATCAATAAGGCGCTGGTAGATCATTGGGGCATTCTTTAATCCGAAG
GGCATCCGCAGCCACTCGAAGTGGCCAAGCGCGCAAACAAAAGCCGAGATCCAACGCGCCCGTCGAGTCATCATGACCGCCCAGAAACCGCTAGCAGCAT
CCAAAGAGCAGAACCATAG