Description :
From Genome Similarity Track
Location :
scaffold_96:9089- 10425
Transcript NameFunction/comments
g13096.t1 hypothetical protein PHYSODRAFT_506240

Sequence
1336 bases(100 bases per row)
TTGAATCTCCGCACTCGTCTTGCCCGACGTCTCCGGCACCAAACTGAGTGCCATGCAGTAAAAGACCGCCAGCAGCGCCACGAACGGCAAATAGCTCAAG
TCCTGCAGCGCGTCGGCCAGGTACGGGTACGACACCCCCACTACGAGGTTGCAAAGCCAGTTGATGCCGATACAGAGCGAAGACGCGTGCGCGCGAATCG
CGTCTGGGAACATGTCAGCAGTCATCACCCACACGAGCGGACCCAGCGTCACGCCAAAGATGACCACGTACAAGGCCGTGAAGAGTACCGAGAGCGCAGC
CACATCCACGAGAAACGCCACCGTCATACCAACGGCCATGAGCAACATGCCTGCTAGTCCCCACAGGATCATGACGCGATTCCCAAATCGAACAGCTAAA
CAGCCCGTGAAGAATGCCGGCCAAATGTTGATAAAGTCGATGATAAGTGTGCCAACGCGAGGATCCGAGATGCCAGCATCCGCGAAAATACTACTCGAGT
AGTAGAACACAGCATTGATACCCGAGAGTTGCTGCGAGCACGACAGCAAGATGGCTCCAGCTAACTGTCGGCGATACTTTGGGTCGAGCAGCGATTCCTC
CACTTGCTTCGCGGTGATCAGGCCTTCCTCGTTGTCCTTGGGCGGTTCGAGCCACGCCAGCACGGAATCAACGTTTCCCTCGCCATAGAGTCGAGCGATC
ACGCGCTCAGCTTCTGCGCGCCGGTTCTTCATCAACAGCCAAGCAGGACTCTCTACACAAAGTGACGGAGCCAGCCCCAGAAACAACCCCGCCAGTACCA
GCGGGAATCCAGCCAGGAACCGCCAGCCGGAGCTTGAGTTGGCGAAGAAGAAGGCAACGGCCGGCATCATGATGCCGAACGTCACGGAAATTTGCAGCCC
CAGGCCCAAGACGTTGCGCAAGTGCGGAGGCGACAGCTCGCTCACATAGGCGCCGATTGTCCCCGTGGCGACACCCGAAGCGATGCCCGAGATGAGTCGG
CCCGCTGCAAACGGCCAAATGGTCGAGACGCTCATTTGGACCACAGCCCCGACCGCGATGAAGCCGCAGTTGGCAATCAGCAGCTTCTTGCGGCCCCACA
AATCGCTGCATCCCCCGCAAAGCAAACTCCCGAGCATGGCGCCGAAGATCCACGCGTTCACGGCGAAAGTCCATGCCAGCTTCGAGTGGCCGGGGAACAT
GAGGCACGTGCCGTCCGCAACGGGGCGAGCTTCGCACTCGGTGGCGTCGTTGAACTGGGCCAGATTGAGCTGCGACGTGGACCAGCCGCTCTGGAAAGGT
TGGAGCAGGGACACGAGAACGCTCAAGTAGACGGCG