Description :
From Genome Similarity Track
Location :
contig_5:90888- 92212
Transcript NameFunction/comments
g1306.t1hypothetical protein F441_19129

Sequence
1324 bases(100 bases per row)
AGGCGTGTTTACGTGCACTTTGCGTAAAAAATGGATTGACCAATCACAGCGCGCTACATACATTTTTCTGCGTGTATTTGTTCATTGCTTACGTCAAACG
ACCTTCAGAAGTCGCCACCACTTCAGAAGCCAATTGGCAGCAATGGCGTCTGCGATCATCGCGTTGCCGACGTCCTCCCCGCCGAAGAAGTTGCGCGTCC
TGTGTCTTCACGGCTTCCGCACGAACCGTCAAGTGATGGAGACCCAGACACGTGGACTGCGGGACGCTCTGGTCCCAACGCCGAGTTCGTCTTCCTCGAT
GGTCCGTTCGAATCCCGCGGGCCGACGGACGAAGTCATCGAGCGCTTGTTCGGGGACACGGCGCCGTTCTACGAGTGGTGGGCAGCGCGTTACCTGGAGA
AGGAGGAGCGGGAGGATATTGAGGCCGAGGAGGGCGTCCCAAGGGGCACTACCAAACGCTGGTGCCTTGAGTTCAGCGACATGGACCAAGCCATCGAGTA
CATGGACGAGAAGCTCACGCAGCTGGGCGAGTTCGACTTGGCCGTGGGCTTTTCGCAGGGCTCCATCATGCTCACGATTTTGTCCATGTGGTATCTCAAG
AAGACCAACAGGCGCTGGTGGAAGCTCGTACTCTGCGTCTGCGGCGTGTATCCGCGCGGCATCAACGTCCGGGAGCTGTTCGAGACGCACGACGGACAGC
CGATTCAGGTGCCGCTCCCGTCGATCCACGTCGTGGGGAAGAAGGACAGTTTGTACCAAGAGTCGCTAGTTCTCAAGGACATGTACACAGCGCACGCCAA
GGCAGCCCCTTGGCGAGACTGCTGCTGGAGCACGACGGAGGACACAAATTTCCATCTCCCGAGCGACACCAGGATTTTTATGCGGACTTGGCCAGCACAA
TCTGGCAGTTCTTTGAGGATACACGCCAGAGCTCGGTGGCACGACTCTGAGGCGTACTGTTAGTGTGTAGACAGCAACCACCAGAATATAGTCACTGCTT
GACGTGTTTAACAATCCGAAGTTGCTCAATTTGAGCCTCAAACACCAGAGTTGAGTCGCTCGTGACGTCAAATCCATGGCCAATTTGTGTACGCCAGCCT
GCTTGAAGTTGGATCTGCTCACTCGACATTTTCCAGCATTTTCCAGCACTTCCCATGGTGATCGTCGCCGAGAAGCTGCCTCACCCTACGGCGCGTAACC
CGCGTCCATTCGACTCGTCTAAGAAGATCCGCGTGCTGTGTTTGCATGGGTTCCGCACGAACAGGCAGGTGATGCTGGACCAGACGCGCGGGATTCGAGC
TGCTCTGGGCGACTCGGCAGAGTT