Description :
From Genome Similarity Track
Location :
Scaffold_86:90867- 93110
Transcript NameFunction/comments
Phyra_83301Hypothetical protein
Phyra_83302Hypothetical protein

Sequence
2243 bases(100 bases per row)
AGCTGCATACTACGACCTGTGGGCGTTCGGAGACCCAGCAGACAGTCCTCGACGGTACCTTCGAGACTTCCGACCGCGAGCATGAGAGGGACCACTTGAT
CGCCCCGTTGGGGGTCACGCAGCCTCGATGCACTTTGCCGCTCCGCCGCCGCGGGCCCGTATTGCTTGTAGAGCGTGAACCGCTCGTGCTGCTTGAGCTT
CTTCCATTCGCTCGCATTGACCTGTCCATGGCATGTCGTCAAGAAATCGTGATAGTAGTCGCGCGTCTCCTCCACCACGCTCGACGCGTAGTCCTCGAGG
GCATCCGCCTCGTCCGGAGGGAGATCGATAGAGGGGAAGATGTTGCGGGGTAATGGGAGCTTCATGATCTGCTGCTGTGGTGGTTGCAACGCAAAGTCGC
GAATGACCGAGCGCTAACGTGCTTCGGGTTCTTGCTCACGGACGGGACGCTCGGTCGCTGATGGCCTGCGTGCTCTTTGCGCTTCAGATGAAGAGACCGC
CGCGCTGCGAGGGCTTTCAACAGACGAGGCCTGATCGTGAGCGAGGCTTTGGAAAAGAGCCAAGAGAGTGCAATGCAGTCGTGGCGTTAGTAGAACTGTC
TAAGGCGCGCGTCGTGGCCGATGAAGACGGCGGAGGCTTCGACGAATGTTGGCCATGGACAGCACCGTCGTGCTTTCGCTGACCACCAGATAATGGATAG
TGGGAGCCTCATTTCACCGCACGACCCTCGTGCACACGACAAAGGTGGCGACGGTATTCGTGTGGAGACCATCACGCGAGACTGCGTTCACCGTGATGTC
GGTTGGCTGCTGTAGACGGCAGCAACCAAGGTGAACGCCTCGTTCAATGAGCAAGCCGGCGCTCTTGACGGACAAGAGCATCTTGTGTGCGCTAAATAAT
GTTGTCAACATCGTTGATTACCCTTCCGAAGCTCAGACCCGCCCCTCGAGGTGATCCAACGCCGGGTTTAGCAGGCTGAGTCGGTCATGATGCCCTGCCC
AAATTACCTGCCGACAAGATTTGCTAAGTTTACCACCTCGCTTCAACTCGATCCTCGACTCTCTCCGGAGCTCCATAGCCATGCCTCGCCTCGATTTAGA
TCTTCTGGCTTGGACTCACAGAGACGAGAGCAGTGTGCAAGTTGCAAGCCAAGTAAAACTTCATCCAACGTCGACGATGACCCGGGTTGGAGAAAACAGT
ATCGCTTGTCCGGAGATGGACGAAAGACGCGAAGCTTCGTTGCCGGTCGATGGAGACGAGAATGTACCAGTCGCAGACGACAAGAGCGCTGTCGTGCTCA
CGACGGAGGAGTTGACGCCGCTAGCCGAAGTTTCGAGCGTCTCGGTGGATGACATCGTCCACATCCTGGCGAAATCTACGGACTGGCTGCAGCTGTACGA
CGCTGTCGTGACGCTGCGCCGGGTTATCGTGCACCATAGCGAGGTGATCTCGAGCAAACATATCGAGGAGCTCCTTCGACCACTCGCGCTAGAATGTGAC
AGTCTCCGCTCGTCGCCGTCCAAAAACGGTCTGCTGGCATGTGCCGAGTGTTTCCAGTTCCTACCTCGGTCGATGTTGGAGCGGCAGCTGTTCGGCAGTG
CCCACCCGGAGGTCTTCGACGTTCTTCTCCGCCGCTCCGTGTGCGAGAAGAAGTTCCTGCGCGACGCCGCTGCAATTGCAGTGGATCAACTTGCTACCCA
CCTCACCGGTCTACCGCTTCTTGCAGCCGCTGCTCGATATGGTACAAACAAGAATGGGAAGCTGTGTGGTACGGCTGCCAAGACCATTGCGTTGAGTTTG
CTACGCTTGAAGCAAGACCAAGACGGGGGTGGGCAGGTCTTGGCACTCAAAGGCGAGCCTCTGCGAGCAGTGTATCGAGCCTTGGCAGCATTTCGTGAAA
GCAAAGATGGCACCGCACGAGCCGAAGCGACTGCAAGTTTCCAACGACTGGGCGAGTTACTCGGGCCGGAGGAGCTGGCGCTTGGCTTGAAAGGTGCTAT
GCCTGGTGCTGGGCAGGCTGGTATCGTGGCTCGCATTCTCAAAGACGCATCCCCCAAGTCAAACGCGTCCAAGGCCCGTCCTCGAAATGGGACTCTCCGA
GACCGTGTGAGGCAAGACACCAACGGACGGACCGGAACTGTTGTAAAACACGAGCGTTAATACAAAACATTCTAATGCCTGTGTGTTGTTCGTTTATGAG
GTTGTAGCACACTGCACGCTGTTCGTCTCAGTGCCATGAGAGC