Description :
From Genome Similarity Track
Location :
Scaffold_64:9085- 10324
Transcript NameFunction/comments
Aphas_H257_14758Hypothetical protein

Sequence
1239 bases(100 bases per row)
GTCGTCGATTGTGTTCTCGTTGGCGTCGATTCTGGATGACATTACCAACAACAAACCCACGGCCGCCGACGAGTACGACTTGTACTTTGTACCGATCGTC
AACATTGACGGCTATTCTCACACGTGGAGCGGTGACCGGTTGCGGCGCAAGAATGAAAACGAAGTCGACTTGAACCGCAACTGGCTGACCAAGTTTCCCA
ACCCCGAAATCCCTCCCAAATTCGACGAGACGTACCCCGGACTTAAGCCGTTCAGTGAGCCTGAAACCGCGGGCATCAATGATTGGTTCCAAACCAAGCG
CAATGAAACCCAAGGGTTTATTGACATTCACTCGTACGGGGGGCTTATCTTGTCTCCGTACGGAGACATTAACCAGCCAATCGGCGATGGGTTTGACGAG
AAGTTCGACGTCCTCGCCCGTGGATTGCAAACCGTCATGGGGGCGTACACCCCTAAGCCGTTGGCCCAAACAGCTGCCATTTCGTATGGATTGTTTCAAG
ATTACGCGTTCCTTGAGTTTCAAAAGCCTGCCCTGACGTTTGAAATTGTCGGCGATGATTTTATCGTGGACGTGACGACCATCCCGACACGCGGCCTCGA
AGTGTACAAAGGCATCAACCAATTCGCCAAGGAAGTCACCGTGTTCAACGATGGAGACGTCGCGCCCACAAAACCGTCATGTGGTGATTAGTAGCTAAGA
GCTCGACTTAAAAGTCAAATCGTATTGTGTCAATGGTACTACTACAGTACAGTATCTGTGGTTCGTGGTTTTCAACTCCCAGCACAGTTTAGCACGGAGA
CGTAATAACGGCGCCGAAATACTCTGTAACGTTACTCATAGGCTACATAAAAATTGCCTCGAGGTTGTCCACTCGACTTGACCTTCGACTTCAAATCACT
TGGGTGTTGTTTACAGTTAACAGTAAGCCGACGTTCAATTTCTCGACTTCTAGTTAACTGCTCAAGTGCGACACTTCAGCATGACCTGTATGAACTGTAT
GTACCCTTTGACATTGTGCCGTCGATGGAGGGATCCTTTGGTCATTGGAAGAGTGATTCTTAAAGCGGAGAGTTTATGCAGTTCACAGGACTTGAAATCG
TGTCGAAATTCGTGGTACTGGTGCTGATGAAAAATGCATGTGAAGTGGGTAGCTTTTCATAGGCTAAAAACGGGAAAATAATGAGTTTTGTTTGAATTTA
ATTGGTTTATTTTCCCTCAATCCCACCTTGCCTGCTTTG