Description :
From Genome Similarity Track
Location :
contig_8:90825- 92299
Transcript NameFunction/comments
g1803.t1XP_009524953.1 DAHP synthetase phospho-2-dehydro-3-deoxyheptonate aldolase [Phytophthora sojae

Sequence
1474 bases(100 bases per row)
GAAGCTTCTTCGCCATTTTGATTAATGGCTTCATGGGCAAATTGAATGCGGCTACTCCTCGCCGCTTCAGGGATAAAAGAAGCAACCGCAGCAGATAATG
TGCGTTGAGGAACTGTCATTTCAAAGATTCCTCCGGACTTTCTTATTGGTGAGGAAGTCCAATCTTCAGAACACCGAAACATGATGACCGACGCGCTCGA
GCAGGCCAATGCACAACTCACCGCGATGATACACATTTACGCTAACCAGTGTTGAGGTTAGTTTTACTATGAATACGTAGCGTTATCGTGGCAAAAATGA
AAACACGATCAATTTGTACCCCCTGGTGTATAAATAAAACCCCGTTAATATGACCTTTGGATACTTTCAGTATCAATAATGGCTACATTCGTTACTTTGT
CCGTCATATGCGGTCCATCATTTTACTGTTCCGGGGGTACAATTCACAAACTGCAACTGCCAGTGCCGCTTCATTTCTCAACTTGCCGTCTACCCACAAG
TGAATCTTCAGCATTGTCAATGCCCAGCCACAGTGAGCCCGAGACCAACCACGCCGCCAAGCGCCAGCGCCTGGAGGACCGCAACGTGCTGGCCATCAAA
CCGCTCGTGCCGCCCGCCTGCGTCCTGGAGGAACTGCCCGTGACGCCGGAGGTGCACGACCTGGTGGACAAGACGCGCACGGACATCTCCCGCATCCTGC
ACGGTCAGGACGACCGCCTCGTGGTGGTCGTGGGCCCGTGCTCCATCCACGACGTGGCCGCCGCCATGGACTACGCTGCGCGCCTCCAGTCGCTGGCCCA
GGAGCTCGACGGCGAGCTGCTGGTCATCATGCGCACGTACTTCGAGAAGCCGCGCACGACCGTCGGCTGGAAGGGACTCATCAACGACCCGGACCTGGAC
CAGTCCTTCCGCATCAACAAGGGCATCCGCATCGCACGCAAACTGCTGTTGGACGTGAACGCGCTGGGGCTGCCCGTGAGTCTCGAGTTCTTGGACACCA
TCTCGCCGCAGTTCACGGCCGACCTGGTGTCGTGGGGGGCTATTGGCGCTCGCACGACCGAGTCCCAGCTGCACCGTGAGCTCACGAGTGGCCTGTCCAT
GCCTGTGGGCTTCAAGAACGGCACCGGCGGCAACCCCAAGGTGGCAGTGGACGCGGCCGTGGCGTCCTCACAGCCGCACAACTTCTTGGGTTTGAACGAG
CACGGACTCGCGTCCATTGTGCGCACCAAGGGCAACAAGGACTGCCACGTGATTCTACGTGGAGGCTCGAGCGGCCCCAACTACGAGCAGAAGTTCATCG
ACGAGGCCGCCGAGATGCTCACCAAGGCCAAGCAGCCGTCCAAGATCATGGTCGACTGCTCGCACGGCAACTCCCGCAAACTGCACGCCAACCAGCCCAA
GGTGGCCAGCTACCTGGCGGGGATTGTGGCGGAGGGCCACGCGAACGTGCTCGGGCTCATGATCGAGTCCAACA