Description :
From Genome Similarity Track
Location :
scaffold_609:9081- 10158
Transcript NameFunction/comments
Pl_103471conserved hypothetical protein

Sequence
1077 bases(100 bases per row)
AGAGCACTCACCCTTGCTGTCATGGCCGAAATCGTCGCTGCGTATTGCTTGGCTCTTGTCCCACAGTTGCAAGTGTCAGCAATGCAGATGGGAACCACGT
TGAATCAAGAGATGTGGCAACAAGGAAGCCTCACTCTCGACTTGGCGAGGTAGCGAACAAAGGCGTCGGATACGTTGCCATCGCTCAGGAAAACGCGGTG
ATCGATCACCACAAAGAGACGTACTACCGATGCCTATCACCATGAGTCGACAGACCTCCGCCTCGGAGTCGAATTCCTCTGGCCGGTACGTTCGAAACTG
CATTCGCGTCCGACGTAGCATCGGTAGACTCCACTACGTGACTAGACCCAATTCATTGATATTCTATGCGTTCTCCTCATTGTAGCGATCTCAGCGACAA
TTTGCACGACAACGGTGGCCATTTCCCACTACCCGACGACTATTTCCCGGAGATCCACCTCACGTCCAGGGAGATCAAAAACTACGAGTCACAAATGGAA
GAGATTGTCAAGAACGCGTTGGCTGAGTACGAGCTACACGAAGCCAAAGGGATGTACCCCGTATACCGTGCTCCGTGGAGTCTAGTGAGCAAGGTAGAAG
GTCTCACAACTATCAAGAAGGAGACACCTGATAGCCCCACGGCCAGCCAAGCTCGCATCTTCGGCCGCATTAATGGAAACTACCGCCATTTTATTGACTT
CTTTTATGCCGAGACGTCAGCCGAACTATTCGCTTGGAATCAGTTCATGTTCGGGTACGCTACGGACGCGGCTGTACTCAAGAACATCCACACAGTAGCG
TCCAAGAAGAAATGTCTGTATATGGGCGTCAAGTGGACGTGCCTGAACCCGTCACCGCTCGTTAAAAAGCGTGACAACTGCTACATGGAGTACATGATCT
ACACGAAGGATCTACGTGGTCGAGATGTTGGAGTGCGAGTCACATTTCCGCTCGACATTCCAGAGTGTCCTGAGCTGCCTAAAAAGCTTAGGACCAAACG
AATTCGACTTAACACGGTTTGGATTACGCGACCTGGTGACAACGAGCCCAATGTTACCGAGTTCTTCATGCTGTCCC