Description :
From Genome Similarity Track
Location :
Scaffold_1381:908- 2611
Sequence
1703 bases(100 bases per row)
ACATCCACACAGACACGCAGATCAGAAGCAGCAGCACCATGGCGCACTTCGGGCACCACCAGCCGCTGGACGACGAGGAGCTCCGGATGTCGCTGGACGA
GGACATGCGCGCGCTCGAAGCGCTGGGCGCCGAGGACCCGGATGTGGACGTGGACATAAACATGGACATGGACGCCGTCGAAGCCCTAGACGGCTTGGAT
GACCAGCAGCTGAAGCAAGACCAGTTGAAGCGAGAGGAGCTCAGAGGCGACGACGGTGACGTATTCCGGCCGAGCGCGATGCTCGACCGCCGCATGGAGG
AGGAGTGGGTCGGCGGCGCGTTCTACTCGACGTGCTTCCAGGCGTCCGAGCTGGTGGAGAAGGACCTCGACGGCGGCTTCGTCGACATCGAGCAAATGTT
GCTGAGCGAGTCGGAGGAATTTCTGACCGCCCACTTCGCGAACACCAGCGACGACCAGCTCCACGCGCAGCTGCTTGACGGAGCGAACAGCGGTGACCAG
AGCGATAACCAACAACGCCAGCGCATGATCCGAGCCGAGATCACTGCGCGCCACTTTCTACATGCAAAGCGCAACGCCAATGGCGACAACGACAGCGACG
CCACGCAGTTGCAACAGCAGCGACTGGTGCTGCTCAAGCAGGCGATCGCGTCTTCGTCGCTGTCGTCGTCGTCGATTTTCAACATGCCTCCAAAGTACTT
TGAAGGTGGTGTGCAGAGCTCACCGCAGAAGCGCCGCGCGTATCGACGCACGTTCGGCGAGCACACGCAGCCGTTCACGTTCGGAAGTAGCAGCAGCAGC
ACGTTTAGTTTCAAGCAGGAGGACCAGCAGTCAGCGCGAATGACCAGCGACTGCTATCACCAGATTGGCGGCAGCGGCTCGACATTTAACGACGAGAACT
GTTCACCGCACCCAAGCGCAGCCTCATCGGATGAGGTGCGCATCAAAGAGGAGATTGTGGACGCTAGCGCTCACCAAGGTGTTCCCCGCGCAACTGCTAC
TGTTTATGCGAGTGAGTCAGAAATCGAGTCGATGGACGAGGGTCACGGAGATGAGGAAGAGCTGAAGGCAGCTGCAGAAGCGAACAGTCGCGCACAGACG
CCAGTGACGCTCGCTCCGTTCACGGGCTTCCGAAGTATCAGTGACGACCTCCACCAGTACAACAATGACGAAGACGAGCACGAAGTCACGAGGACGACGC
TGCGGACGCCATTGCGCCGAAGTCTGTCGTCTCCAGCGCCGTCAATCGCGGCAGAGCAGCAGTTTACTCCCCAGCAGCAGCAACACCTCTCCGGCGGCCA
CGCGAGTCGGTCCATGTCGCCTGCCGACGCGTTCGAGAAGGTCGCGGTGGTACTGCAGGTCGCCAATGACTCACCAGGACGAGTTGACAAGTTTGAGTGG
CGCATCGGCGGCTCGGCACAGACTCAGAATCAACAGCAGCAACAAGGAAGCAATGCAAGCAGCAAGAAGCGGCCAAACCTATCGACGCAGCTCGGGAAGG
CGGACGCGATCCTCAGATCGAACAGCGACGGCTCGCTCTCCTCTTGTCCTTCCTCTGAACTGGACGATAACAGAACCAACACAACAGCTGCGACTGCGAC
GCTTCCACCTCGGTACTTTCGCGGCGTCACGAGCTCCCCTCAGAAGCGGAGAGCGCACTCGACCACGTTCGGCTCGTTCGCGCGTTCGTTCTCGTTCACG
GGC