Description :
From Genome Similarity Track
Location :
Scaffold_2630:908- 2486
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_2630-abinit-gene-0.3Lipase/serine esterase

Sequence
1578 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTATCA
TAATTTAGACGTGATGTGACAGCTCCGGGTGCGGCAGCACGAGTGTTTTGCTAAAGCTAAATCACCTCGCTGCTAAAAATGCCCTGTTTATGAACAAATT
TAACAGTAGCAACCATCTCAGGGGTGCGGATGACCTAACTAACAACAAGAAATTAATTGGGTAAAACCAGTTGCTTGAATTTTACAGTGAAAATTGGTCT
CCAGGTGCAATTGACGACTGGGAGGACCTTCAGTGATCTTCGTGACTTCCACAGCGCAAACAGCATTGCCGTCGCACGTTTCACGAGCAGCCGTCGTCTC
ATTCTCCTCCGCGGCGAACGCAGTGGGGTCGCTACTGCTTGGCAGGCGATGGAGATCACTCGGGACGGTACAGTCGTCCACGGTTGCTGGTTGTCGATGG
ATCGAGCGTGGCGCTAGAGCCTCTTGGTGACACTCTGGTCGCATGTTGCTTGTATGGAATCCTGTCGAGCGTGTCATCGTCTATTGGCAATTCCCTCGAT
CATAAAAACCGGAAAATTGTAGCAACAGCAGGATACCCGAACAGAGTCGACCTGACTTGGATACCTTCATTAACGCACCACACCTCCACTGTGATCAGCT
AGGAGGCGAGATGAGATCAACACATTTGGTTTAAGGTCTTGTATACGGTATCTACCTGTTCACAATCGCGTTTCTTATGAGCTTGGGAGAGGTGTGCTTG
TCACTGATGAATCGGCAACAGAATTGGTGACCGACTCGGCTGTTGAGGACGAGAGGTGGTTTTCAGAGGTCGTCGTCACCGCTTCTTTCTTCTGGAAGCG
CTCGAACAATCGGTTGAATCCGCCGCCAGCCCCAGTTGAATTCCGATGCTCGCCGTTCTCGCCAGCACCTGGACTTGGCATGGGCGACGGCTGCGCACTC
AGCGCTGCCCCCGGAGAAGCTGTGGTGAACGAGCCTTGTTTCTGGAATTTCCCCATCAAGCGACTCATCCCATTTCCGATGAACGAATTGCGTGACTCTT
CACTGGTGCTGTAGCCATCAGCACTCGACTGGGACGACGAGAGCCCACTGTCTTCGGAAGATCGACTCTCAGCACGCTTCTGAAATCGCTCAAAGATGCG
GTTGATCCCATTTATCCCATTGCCAATGAAGGACCCTCGCGGTTCTTCATCGCCGACGCTGTCATCTGCAGAGTGCGCTCTCTCGTCAGCTCCAAATGGC
GACGGTGATTCCGGCAACGCGTCCATCTCATGATCGTGGCCAATCATATCGCAGAGCAGGTCGATGAACTCGTCCGCGCGACACCCCGGCGGCTGCATCT
TGTTGATCCCCCAGTCGTGCAGTCGGAGCTTGCCTTTCACGCCGAGCGGCTCGACCGTGACGTCGATGCGGCGCCAGG