Description :
From Genome Similarity Track
Location :
contig_54:9079- 14072
Transcript NameFunction/comments
g9122.t1hypothetical protein

Sequence
4993 bases(100 bases per row)
CGCGCAAAGCCAAAATCGGATCACTCTGCAGGCTGCTTTTGATAGCTTCGAAAGCCTGCTGAGCTTCGTCCCACGACCATTCTGCCTCCTTCTTCAAGAG
ATTCGTCAGCGGCCGTGCCATCTTAGTATAGTTGGCGCTGTATTGTGTAAGTAGCTGGCAAGGCCAAGCCACTTGCGCAAGTCCTTCCGAGATACTGACA
CTGGCCATTGCGCGATCGCGCATATCTTCTCAGGGTCCGCACGGACACCATCTTTGCCAAGGAAACATCCCAAGAAGGGAATCTCTTCGGCTCCGACGAT
ACACTTGTTGATGTTCGCATACAAGCGATTATCGCGCATGCACATCAATAGCTCGCGGAGGTGGTAACGTACACTTCGACAGCCGTCTTACTCCTGAGGC
ACGACTGTGCACGAAGATATCATCAAAGTACGTCTGTACGAACTGCCGCATCGGCCGGAAGAGTTGAGTCACCAGTCGATTGAACGTGGCTGGTGCGTTC
GACAGCCCCTGGGGGATCACGAGCCATTCCCACAGCATCCCGCTGGATGTGCTCACCGCTGTGAGCGGGACGTCTGATTCCCGCATCAACAGCTGATAGT
AGCTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATA
GCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCAT
TAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCGTTTGGTTCATTTATCTAGGTTTAAGTATAC
TTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCA
TTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATG
TCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAG
TCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAAC
CGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTC
CGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGA
GGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAC
GAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGCACGGTACTTGGTCTCGAACATCGTGAC
CAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTC
GAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGC
CGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAAC
ATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGG
ACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCAC
TGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACA
ACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAG
AACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTG
TTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATG
GCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAAC
GACTGCGAGAGTCGTTGGAAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTG
TCGACAGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAG
TGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGC
GTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAA
GTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGT
CGAGACATTGATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCC
CAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGA
AGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGC
CCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCG
TGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACA
AGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGAT
GCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGT
TCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCAGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAG
AACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGG
CTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTG
TATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCT
ACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGC
AGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGT
GGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTG
GTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAG
TGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTG
GCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTG
CAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGAT