Description :
From Genome Similarity Track
Location :
Scaffold_665:9078- 12142
Transcript NameFunction/comments
Phymu_g11439hypothetical protein PHYSODRAFT_506430

Sequence
3064 bases(100 bases per row)
CAAGTGCAACGCGCTACTATTTAGTTGGGCGTTTGCACGGCCTCAAATGCGAGGGATTTTTCGGTGCTATCgtcgtcgtacagctcgaCGTTCTTACCGC
GTGGCTCGTAGCCGAAGAACAGCACAATAgccgccaccaccatcaGCAGTCCACCAAACACCCACATGATGGCCTCGAGCGACACGTTCCAGTCACCAAA
CATGGAGGCGCACAAGTACGGACCACTGAAGGAGCCGATACGGCTGAAACCCGAAGGATAGGCAGCCCCCATGCCGCGAATGGCCGTCGGGTAGTTCTCC
GGGGTGTACGCGTATACGCAGCCCCACGCGCCCAAcatgaagaacgacgtgaaggaGCCGGTCACCATGACAGGGACCTTGGACGCATCGACGTAGCCCA
TTGCAATGGCGGACACGAAGGAGCCGACCAGGAAAATGACCAGCGTCTGCTTACGGCCGAGGATCTCCacgagaccagcagcagcgaagtAGCCTGGAAG
CTGGAACGCCGTGATAATTAGGATGGTCTCCCACTGGCCGTTCATGTTGTAGCCCTTGAGCGAGATGAGCGTGGGCAGGTagatgaagatggcgtaGTAC
GACATGGAGATACCGAACCAGAGCGTCCACAAGACGGTAGTGCGCACGCggaactggcgctggaagagcacgCCAATGCGCTTGAAGTGAGACTCCGGGA
GTTGGGGCGGGGCAGGCGGAAGCGGCTCAGCGCTCTCAACCTCCGACTTCGGGTCGTACGGGTCCATACCGTGGGCGCGCTCGATAGACTCAACGATGGC
GACGGCCTCGTCGTAGCGGCCGACACTGGCCAGCCACTTGGGCGACTCTGGGATGTACATACGGATGACGATGGCGTAGACCACTGGCgcgcagcagatg
aagaaggtcTCGCGCCAGCCGATCCTAGGCGCAGCGCCAAAAGCCATGACAACAGCCAACATACAGCCCACAGCCCAGAACGCCTCGAGCAAAACGATGA
TCTTGCCTCGGGTCTTCTTGGGGGAcagctcctgcacgagcGTAGAGGCGACGGGCAGCTCACCACCAAGCCCAATACCGGAGATGATACGGGCGCAGGT
GATGGAGGTGACGTCCCAGCTCACGGCGCAAAGGCCCAgaccgacgaggaagagcacgagcgtGACCATAAACATGGGGCGGCGGCCGTACTTGTCCGCG
AGCGAGCCGAAGGGGAACGAACCGATGAAGGAACCGACGAAGACGGCTCCACCCAGGAACGAGGCCTGGCGGGAGCTCTGCGGAATGTCCTCGCGGATGA
GAGCGGCGCAGTACGTGAAGATAAAGGTCTCCATGGAGTCCATGGCCCAGCCGAAGCCCGTGAGCAGGATCAGCTTGATGTAGTACCACGATAGGCCCAT
GACGACGCCCGGGTCGCGCTCGCCGATGGCATCGATCCGTCGCGTGATGCGCTGCACGGCCTCCACGTTGTCCGCGGGGGTGCTCATGTTGCTTGTAGGT
ACAGTACTGGCTGTTTGTTGCCCTTGAACACGCGCTGGATGCTGCGAAGTGTAGGTTCTGGTCAACCTCTGGTGGCGTTACCCGACGACGATGAATCGAG
AAGTGAGCCGTCAACCAGTGCTTGCGATACCGGAATTCAAATTTGATACTAGCTGTGATCGACTTGGAAAGGGAAGAAATGAGcatacaaaaatcaagtg
TGATGAGGTGCAATCGAACGCTGACAGCTGCTGATGTGGGCGCGTGGCACGGCACGCCACGATGCTACGATTCAGAATATTCTGCTACTGAAACGGTCTG
AGAATAAAAAGTAGCCAATCCAATCAAAGCAGATATTGTTGCGAACTGAGGCTCTGATTGGTTTGAAAATCCGTATCAATTCGGTCGCAGCAGGCAAATT
TTCGGGACGTATAGAATGAAAACAGCTATCCTTATCCAACCCTTTCTTTTCAAACCCCTTACCCTACATGTCACAGCTACCTGAATGATGGTCGTGAGTG
AGTAAATAGACTCGTCTGACAGCTCTGGAAGGGAATAGAGGCTGGACGAAAATTAAGGCCCGACCTCTTTGACAGCCTGCTGTTCATTTGGGTACTGACG
AAATTTTTTTGAGGAAAATTTTCCTACTATAATGTACAGTGCACGTCAAAAGTTTatgagtacatgtaccgtagACACAAAAAAACGAGGAACGGATAAT
TTTGAAGGCTGCATACTAATATTTTGACTAATCTAATGGcaataaataaaataattACCAATCACTATTCTTAAAATTTGGTTGGAAGGAAAGCAATTTG
AGGGCTCACTGGTGGACAGGACCCGCTCCTTTTGCAACGGAGCGAAAACAGAATGGGTACTCCATCAAGCAAAAGTTGGAGGGAGTAGAGCTAGTGGCGA
GGGTTGGGCTGTCTGCTGCAGTCAGCCGGCTTGGCTACTCCTACAGCACCGCGCATGGCTGGTGGCACGAGCGTGACAAGCTTCGTGCCTACACAGGAAA
CATGGCcgccaagacgacgaaagGGCAGGGACGAAAGGAAAGCTTTCCGCTCACCCCTGCCCTCGTCACCTTAATGAAAGACATCCGACGGGGCGAAGAC
GTAAGTTTTGTTTATTTTTATTCGTTCTGCTAACGCGCTATACAACTGGGCAGTGGCTTACTACGTCTAGAAGGATCGCCTTTATCCAAGAAAATTATTG
TGATTGGTTGGAAGTATAtgcagaagacaagaagTCTGATGaaagctgccgtcgatcGCTAAAACAAAGTTGCCATGTATAGACCTCCAATGTATCAAGG
CCGAGTTTGCCCTCGCGTTTTGGGACCAATACAGTGCATATACCCCCTCAGAGAGATATAATGTTGACGAGACTGCAATCCAGTTTGACATGCCACCCGC
ACGAATTTGGGGCGTCAAAGGGCGTAAGGGATCCGCGAAGATTCGCGACCTTACGAAGCACTGCGATGGCATGACAGCAGTCTTAACGATTCGAGCTGAC
GGTGAGctttttatttattttattttttattatttttattaacattttgtttttaaaaCGCCTT