Description :
From Genome Similarity Track
Location :
scaffold_1:907757- 910332
Sequence
2575 bases(100 bases per row)
cggggaaacgagacaaccagtaggcgcggggcgccccactgggggagaactgagttttgctgAGCGTCAAAGCAGTAGAGATCAGCAAagtccagccccg
aagagctccgagctcttGAAAACGcaatgtgtatgcaagccgagcttcctggtcgtaaaagcgactgtgaagggctttgagaagccatagaaGATTCTAA
TCGACCCCGTGGAGTCAGGcaactatgctcgacgcttcacaaTAGAAGTAAGTCATCTGTACGCTGACGCGCTGAgtgcgcggttgagtgataccgtcac
tgtttgcttagcgacggggacttgtgtcactgtgccgaaggtccctgtgggccTCAGAGGCAAGTTTCtttacttcgatagcgtgaaaccTTGCCTAGTT
TTTGACTTGTATTCaagatatgaccttatccttggtaggacatggttggaacacgaTGAGCCATgggttgattggaggtctAAGACCTTAGGCGCTACGA
GCACGTCTCTTGATGAAACTtttgtgagtcatgaacccacctttgctaggaagcagaagcgctattagcgcgggcactggtCAATgtactggatatcgga
gCATCCAAgcgtcgaacaccgaaggtgtattgaacAAAGGTCCGGAGTATgcctcgcgggctgaacttggagtggcacggtatccaAACTGTGAAGtttg
cggaaatagcagctcttcgtcggatgaaATTAATaatatcaaggctccgatggagaagggagtggggacacggGACGACGCTGATCGCATTTTCTCACtc
gtctcaccgagacgtaAAACATCAATCGTGAGGTGACGGCAATGCCGTATTGTTTTTGCAAGacccagggcgtcgaccctgacccaggttgtgtctaccg
tagacgatagcgcacagctatacacccctGTAACGGTGTGatggggaggaagacggcgatgtcCCCCTCGAGGCttttcccgcggtggatgctcgtcTTG
AGCTGGGCGAGATACCCTTCGAAGGGTTTatcagtgccttgaaggcaggcgatttaacCGAGGTGATCATTAAAAGACCGAGCGAAGAGATAAATTcctc
gtcgcttctggataagGCTGTTaaggaggacaccaagagattgatgaacgcacaaagtggatcgtcgatcctgaaggatccctcggatccgtactatcct
ttagtataggaatttcaagacgttgtccacaaagacccgccgtcggtcctacctctggtcgaggtgtgcgtcatgagattgacctgattccgggaaccaa
atactatgtaacacgccaatgaccctgGTCCAAGGAGcaatgtgacgtcattgacgccctgCGAAGCAAGATGCGggaatggtgtgtgagagcaagtctc
cccattcgacacacaggttttgtgtccggaagccgaaaggcaaatggcgtatcgttcacgcttacaataagctcaacgctgccaccattccggcacaaac
gtcaattcctagaaaggatgtttttTAGATAAACATGGTGGGATATACgaaatacagtgcactcgatttgataAATGAATACTACCAATTGTTCATggga
gcgagtgatattccactgacagtggtgagtactccgagcgggatgctatGGGAGTGGATAGTGatgcccaagggctgtcttatgcaccagcaacatccaa
tcgtcttgtaacgcagttgttcaggccccatcgggcatatgcacaaacatacttcgatgccatcttcgtccacagtcgtgtgggGCTCGAATGcgcagat
gaggaaaaccatatcgttcatttgagagcatttcttgagtgcatgcgcacgaataagccgtatgctaatgcagataagtgcatcttcggcgcgggcGATA
TTCTCCTATAAGGAAGCGTGACCTACGAgcaagcggatcccgctaaggtcaaggccattgtggactggtcgattccaaagaaccaaaaggacttgcgcaa
gtggcttggcctcgccatctATTCGCACAAGTATTGCGCAAATAATGCGGGAATGGCACGACTAATGTCGAACCTCCTTAAGAAGAATATCGAATGGTAT
TGGGAAACGAGCGTCGGAGGGCTTTTGAtaaggtcaaagacagcctccttgatgcaacaatactggcgttgccaaacgtcgatcgtctttttagtgtcgt
ctgtgacgcttcgaacttttCCATcgactgtgcactgctgcaagcacacCCCGAGATGCGAGATcggatgatcgcgttcaaatctcgccagcttaaggct
gcggagaagaacttacgaatccacgacaaggaattacctgCGATGTagtttgcacttgtcaagttcagggtgcccTTGCTGggctcaaagccatttgtga
tctacacgcGCGTCCTTgggcactgcgactcaatcgcctcacctctcgcagaggatgaccagatGGCttttattctttgcagaaaattacttcgaggtga
ggtataagccaggaaagcagaatgctttggccgaCGCGTTGttacgcagaccggactatgagcttgcccatgtca