Description :
From Genome Similarity Track
Location :
Scaffold_63:90764- 96113
Sequence
5349 bases(100 bases per row)
CGCAATCCCCCCCTTCTGACATCAGGTCTTTTGCAACAGTTTATAATCCCAATGGACCGGGAGTCTAGAGAGCCGGGATACTCCGTGCAAAAAGCAATGG
ATGCATCATTGGTGAGACCGCAAGGAGCCGGTCGATCGATCTATGAAAGCTCGAGTAGCAACAGCGGGGAAGGCCTCCAAACGGAGCTGGTCGTCATGAT
GGACCGTCAAGCCGCACTCAGGCGAGACAACAAGTTACAGGAAGAGATTATAACTTTAAATATTCTTGGCATGTGCTCGACATGAAGAGCGGAAGATAAT
TCTGGTCGTGGCAAGTTCATGGTATTTACGCGCGCAACACTACGATGTGCCCAGAGCCTTCCACAAAGCCTTCAAAAAGGAAGACGTCGAAATTTATCTA
CGCATCCTCGAGAGCGTGACCATACCTAATGAAGAGCTTAAACGGATGGGATCAAGAGACTATAAAGAAGTTTGCCTCCTTCTCGTTAAGAGCCTCTACA
ATCTTAAGCAAACCGGAAGGCTCTGGAACCAACTTCTGCGCCAAACATTAGTGCAGATGGACGTTACACATTCTGTCACCGACGCCTGAGTATATTTCAA
TAAATTAGTTTGGAAACTATTGTGGTCGGCGTTTTCGTGGATAACTTGACATATAATTCTACCCGGTAGGAGCCCTTGGAATAATTCGGTAAGTACATGG
CGGGTCTAGAACTATAAAGACTGGGACCGTTAAGAATTTTCTTGAAATGCGCATTACGTACGATCCCGGGAGGGATTTCACAGTGACCAGGAGGCGACAA
TCATGGGCTGCTACAGCAAAACAGACGCGAAAAAACGTGGTAATAGCACCGACAGCAGATGAGTCATAATTGGAGTCGGAGAACGAAGAAGTTAAACTTC
TGCCGGAGAGAGGACCTGAGACTCCGAAGAGGCCGAGAGTGAAGAGTTGGTAGTCATTGGTAGGTATCTTGCTATGGGTGGTCAGCAGGCTAGACATAGT
CTACGTAGTGCATCGGACCACCAGACACATCCACGCGCCGACTGAACAAGACATGAAGATATCCAGACTCATTTTGCGGTACCTTGCGGGGACGGCGGGT
TTAGGGCTACACATGAAAGGAACAGCAGGATGCGGAAATGTGATGTTAAACAGCTACATTGACGCTGAATTTGCTGCTGACAATAGTACGGGAAATTCAG
TAAGCTGGGAGCTGGTGCTGGTGGAATGGCAGGTAAAACAGCAGTTGTCCATGGCACATTCGACCGCCGAAGCAGAATCTGTTTCTGCTGCGATGGTTTT
GAAAGAATTGCTTGGAGTGGATAACCTACTGTGCGAGATAGGGGTGACGGCAAAAATGCCGATGAGGGCAATATAAGTAAAATTAGGCAGCCAACAAGCA
GATACAGAACAAAGCGACATCAAGCAGCCAAAAGCACGTAGACGTTGAATTAAAGTTTATACGATACATTAGCGAGAAGAAAGCGTTGCAACCAGAGTAC
GTGTACACTAACTAAATGCTTGCTAATGTGCTGACCCAAAATTCTGCAAACGCCATGGCCGTGGAATTGCGAGAGAGAATCGGATTGAGATTGCTACAAG
CGCGAGGAGTAAATGATGAGTGTTGGAGTAGATCTAGAATGAGACACGGTCCATATATTCAGAAGATAGCTGCTTTGATGGGAAGACAGGTGAGCACCTA
ATTAGTTACGAGAGAAGGGTCTAAAGGAATAATAAATCAGTAAGCATAAGAATCTCGAAAGCGTAATATCTCCTCCTGGCATCAGGTCCTTTTCCAACAG
AACTGTGGCCATAAAGTCCGGTCTGTACAGAAAGTGGTGAGCTATGTATGATCATACAATGTTCAGCGGTTTATTGTGCTCGATAATCTCAACTATAGGC
TGAAAAATATAGGCTAGTGACTCCGGCGGTTTTGTGGCGAAGTGATATAAAATGACTTTAACAGTTGAGTGGTGAAGTGGATAGGGAGACCATGACTAAA
AGTCTATGGGCGAGAACGGAAAATGAAAGTTGCAACGTAACAAGCCAGGCAGATACTGCGAATCAGCTATTTTAGAAAGGAGCGATTGTGGTTAAACTGA
TCAAGATTGTATGGAGCTGATCGCTGGGTCGAGCAATTCCAAAAGATACGATGGATCACTGAAAATAATTAATCGGCTGTTTGAGCTGGGTGATACCAAG
ATCGAATATTGTGGTGAAGTGCGCTCGAAAAAGATAATGGACCCAGAGACTATCACGACGAAGGGACAAGGGGATACTTTCAGGGAAAGGTCGCCTGGGA
GAAGGAGTCGCGAAAGGGTTCAGACCCTCGGGGAAGAGGGACCCGCAGAGCCAATCAAGGAGAAGACCGTTGCTCGAGTACCGGTTGAGCGGTGCCGAAA
GAGGATGACTACAAACTCTCACTGGTGGATCCGGTCTCCAAGCGTATACCGCGGTCCTTATGAGTAGACCGTGGTCCCTCACTAGAAGATCTGATCCCTC
ATTGGTAGACCTGGTCCCTCGATGGTAGACCTTGGTCCCTCATCGGCTGACCAAGGTCCTTCAAGATTCGGTTGCTCCTGACCAGTCACATAAAGAGCCA
GAGCACAAGGGCAGGATAGAGTAAAGAAGTTAAAGGATAGGACGATATTAAATACTACTCAATTTGCGATCCCCGTTTCACGACTTCGTCGTGCGTTAAG
GAACTTGATAAGTCTACCCACCTGTTCTGGGGAAGGGAGATTTTTACCCCCCCCCGTCGAACGAGGTAAGATTCAAGGTCAGATAGAACTCCAGGAAGTA
TTTGGCCTGTGGGTTCGTCGAGTAGCAACAACCCACTCAAGACCCGCTATCAGAGGCGGACTCCCTACCACACGGTTAGGAAGCAAAGTAAAGGCCAGGA
GGTTAATATCCCTGAGACATCAAGGAAAAGACCAGGAGCGACAAGCTACCTGAAGAACTTGGTTATAAGTCCACTCTCGACTGTGTCGATCAAGTGGCTA
CCTACCGGCCCATCCAGTGAAGCATATCCACCTGGGACCCAGGTCTACATCTATCAAGACCGAAACATCTTCCTCTCCGTCCGAGTCGACCGAAGAGTGC
AACCCGCCAGCCGACGGGTACCCAAGGTGAATCAAGATCTATACGCGGAATCGGGGTCCCCCCGTAAGTCGGCAGTCCGGCGTAGTGAGTGTTTTGGGGG
CTCAACACGCAATTTTGAGAACCCACTCCACCACAATATTACAATACCAAGATCGACATTCAAGGATACTAAGATCTAGTGTCACAATACCAAGATCGGA
AATACACTAGGGTGATCAAGATTGGAAATACGATCGGCGATCAAGTGTGATCGCGATCGGGAATGGTGATAGCTGATCGGTGGCTAATGCGAAGGCGATC
TGGAATGTTGATTGACGATCGATGGTGATCGTGATCTAAAAAAATGATCGGCGATCGGAGTGTGATCGCGATCTGGAATGGAGATCGACAATCGACGATG
AGTGGTGATCGCGATCAAGCCCACCGATCTAATGAATACCGCGATCAACAAACCAGTGTAAGCTCTTTGATGTAGACTACATAAACGATGCGGTTACATA
GAAGGGAACGCGATCTGGGTTCGTGAGCAGAGAATGCTATCAGGGACCACGATCGGGAGGACCGCGATCCGGAGTGGGCCACATGCTATGGAAGGATTGC
AAAGCCATTTAGCACGGAGACGACACGTATCGGTCTATCCTGATATACGGGGTAAGCCTAGTCATAGTTTTAGTATTTGGTTGGTTAACATTAAACAGGG
TTCAATTTGCTTCAAAGAACACGTGTCACCTCTTCCGGGTAGGATTATTTGGTCTCCTGAGAGGATCGGTCTTTGTTCCAAGAACATCACTTCTGAATTA
TTTGGTCAGGAGTGGAAGAACTCTCACCCCTCCCAACTGTGATTGAATGCAGTGAACCCTAGTGGTTCAGGTAAAAGATCGCGAGACGGCTCAAGTGGTT
AGAAGGCTCGCGAATCAAGTACCCCATTTTAGACAAGACGATCTCAAGGGAGACCCAGGCAACTCAAATTGAGTCCCCCAAGTAAACCTCGATGGCATAA
AGATTTCCGCGCGATCGACTTCAATCTCAAACACAGTCAAATTCGGTATCGACTCAAGTCCACCGAGAAGAGTCAACCCGCCCTACCGACAGGTACACAA
AGTGAGGAAGTAATAGATCTACACGGAGTCGGCGTACCCACTCCGTTAGTAGGTCGTCTGGGCGCCAGTAGAGTCGGGATCGCATCAGCAGTTTTGCGAA
TCCCACTCCACCACAGTCTCACTGCCATCTAAACTTCATTGTCATCGCCATGGACGAGGCCTTAGCTACCAGGCGATGCCACTCGTTCGTAAAAAGAAAT
CGTAGATCTTGCGGAGTATTAAATGAAAAAGCAGGTATTACTCACACTTGATATTGCCTGATCAAAAAATTAAAGTTACAATATTTACTTAATAAAAAAG
GGAGTGCTCCTAACCAAGAATAAAGTGAATTTAAGAATTCCCTGACAATGATAAGATTAGCTTGGTTTCGATCGCTCAGAAAGATTCATGCCACACTTAT
AATAGCTACACACCACTGTATGGACTTAATGATCGGTGCTGTGGCAGGTGAGCGGAATAGGTGACCTAAACAAATGTACAGTTCTATCGCTTTCGTCAAA
TTAGTGACCATTTGTTTTCGACATTCGCGCATGAAACGCCTAATAAGGCACAATCATGCGATTTGTGTAGTGGCTGCTTCACTTTCTGCCTAGTCTTTCA
TTGGCTGCTATTTAGCCCCTCCCTCCCCCAGGAGTGTTCGTGAGTATTTATTCCTCGTTGTATTGACAGCCCGTTTTTTACAGCGCCACAACAAAATACG
GGCGGTCAATACAACGGAGGAATATGTAGCAACTTGTGTACAACAAACTGACACACCAGCTCCAATCTCATACTGGTTACAGTGTTATGAGCAAAGAGGG
AATGGACGTACCTATGTGTCCTGGACTGTTTTGAACTAGCATAATGAATCATTTTCTATCAGGCAGACTAGTGATATTTGCAAGCAGTACAAACTAAAAA
GTCTATTTTGAGTTGGTTGAACTGACGCAAGGCGAGCCTAGAAGCAGCAATCAACCAATCATTTATCGCATCAGAAATAAACCATGGGGAAGAACTTTTA
TGTTGGTAATAAAGCATGAGTGCCGTTCACTTAATTAATTCGTATAAGTTTCGCTTTTCTTGACCGAATCCTGTTGTAGACCTGGCAGTGACTGTACCCT
AGCGATGTACAATCGCCCCTCTCTATAAGAGACAAGTTTGTGTCCAATT