Description :
From Genome Similarity Track
Location :
Scaffold_15:90760- 93728
Transcript NameFunction/comments
Phymu_g1081protein phosphatase 2C, putative
Phymu_g1082hypothetical protein PHYSODRAFT_508758

Sequence
2968 bases(100 bases per row)
TGTCGATGTACGCCACAATGATTGTGGTATCGTCGATAACCTGCTCTTCCTTCATCCAGCGGCGGTTTGCCTCCATGATCAGCAGATCCACCGCAATCTT
CGGGTCTTGCTGCCCCATTGCCATCTCCATGCACTCCTCGTTCGACATGAACTCCCACAGACCGTCCGTGGCCACAATGAGGCACCGGTCGTTCTCGTCG
AGCCATCTCGTCGTAAACTCGGGCTCCGAGAGCACGCCAGCAGTGTGGGCAACTGCGTCACCAAGCGAGCGCGACATGGCGAGTCCTGGAACGTCCATGT
GACCCAACCAGACACGAGGAGGGCCGTCAATACCATCGTCGTACTCGACAGCAAACACGCGACCGCCACTGGCAATAATACGAGCCTTCTCGTCCGCTCG
GTCAGGCTTGTGGTCGATGGAGAGCTCTTGGCTTCCGAGAGCCTCAGGACCCGAAGGACCAAGCAGTTTCACAAAGCCGCGAGTGATACGCGAGTCACCG
ACGTTGCCCACCACCACTAGATTGTCTCGAACGACAGTCACCACTGCAGTCGTTCCACTGAACTCTGTATCAATGCTCGGGTCTCGCAGGACGGTTTGCT
CCACAGACTGCAGAGTATCACCAATGGCAGTACGCAGACTCTCCGCATCTTGTTGAAGGTCGCCCGAACGCTCGAACTTGGTGTGCGCAAAGAGTTCCGT
TGCAAACTTATCGCGAATAGCTCCCGATACCCCGTCGCCCGCTTCACCATGGCCGTCGAacacacacagcagcagcgattgCGTATTTTGGTCGTATTTG
ATCACCATCGCGTcttggttcttcttgcgcggGTTGTACGGCGCGTATCCCTTCTTCGACAGTCCAGCAAAGGCCACAACCGCGCAATTTCCGTCTGCCA
GAGCCTGTGCACTGCTGTCCACATCGTCAATGGTAGCTGCAGCCATgccgtccaccagcttgttGTCGCTCACAACCGACAGACGACGGCGTTGCAGTCC
GAGCGAATGCTCTCCGCCATTCTCCGAGACTGGGAGCCTGCCCGGAGTCTTAATGGAAATGCCCTTGGGCGATGCCACGTTGGTGGCCGTAGCCTCCTGC
TGGCGGAGCTTGGCCATCGAGCCCATCTTCTGAACCGGTCGACTGGCCATAGTGGTCGAGTGGTGGGGGTCTAGGAAGTGGGAGAAGGCTGGAAGGAGAC
TGGGACGCTGCAAATACCAGAGTGACCTTCTgctccacgtgctgcttggctgcCCAGATCTCGAGATAGTTGACGTAATTTATAGCTTGGAGATAACTAT
AGCAAGAGCGCAATGAACAGGCGTAACCAGTGAGCCAGATAAGGACTGATTTGCCGAGTTTTGCCGTTGCGCGAGCGAGACAGGAAGGCTAAGAAAAGCG
AGGAGAACTCGTCTACCTAAGGCAGATAAGTTAAAATGCGGAATGCTTTTTTGCTTCAAGTTGTAGAAATCTTTTATCTCTCGACTAAGTATAATAAACT
TTTAGAGCAGTTGTTAAGGGTGAGGATTTTACATTAATGAAGAGGTACAGTGCTACTGCAACGTCACTCTCACGGAAATTTTCACTTGAGTGACGTCTTG
TTGTAAAGTGCAACATGCAACATTTTATACGTAGATCGCTTTTAGTCGCTATCATCGTCGCTTTCGTCTtcagaagacgaggagagGCTGAGCGAGATGG
TGTtaggagcttcttcgtcgctgtcgcttgaatcgctggagctgtcgcttTCGGCGCCTTCGTCCGCCttgtcgccttcttccagcttgcgcttcttgcg
gAGACTTTCAACGtcgtccaccacctcgtcGTCATACAAAGCCGCGCGCTTCTCCGGCAGCTTGAACTTCTTGCGCAAGATCTCCATCGCGTCTGCAGGC
AACGGGTCGCCAGTTTTCCACGACTCTGGCAGCGTGATGCCGTGCTCTGTGAAGAAACTCCGACCCATGTAGTGCAGAAGCGCATCGAGCGGCAGATCCA
CTGGGTCACCTGGCTTCCAGCCCGGCGGCATCTGCTTACGGATCTGCGCGTCACTTGCACCCAAACCAATGGGGATGTTGAGTTTCTCAATAGCttcgcc
tccttcgccttcctGCTTCACTCTGGCAGCACTGGACGTGTACTTCTCCGGTCCCTGTGTAACAATCTCAGCAACGATACCACGACTGAGGACACCCGCA
CGCATCATGTGCTCCTGTGGGGCTGGCGGCATAAACCCGAACATTGGGAACtgcaaaagaaaaaaatattagCAATAGAATACCCACGATACAAGCACTA
ACCAACGTACGCCAGGCTGCCATTCCTTCGGCGCCGATGTCGTGCCGGCAATCCGGTGCGCATAGGCAACAATATCACGAGGGTCCAGCACCACTACGAT
CACCAGTAAAAGTCAGTAAATAGATCTACCAGAACCCAAAAAACTCCATCACCTTTGGATTTCTGCTTTGCGTTTTGCAGCACGACGCGGTGTTTCCTCA
GTACATTGGCAATGTCCTCCTGGGAGTGCCGCAACTGTGCTGCATACTGCACGactttctgcttcttgttttCGATCTCCGCCTCAACACGCAGCAATTC
CTTCTGTGCCACTTGGTGTCTCGCCACTAAAAGGGTTATTTGTCAGCTTCAAATGCTCCCCCTTCCGTCATTTCAAACACCCTGCAACGCACATTTCTTG
ACAGCTGCAAGGAGGTCCCGGTCCTTCTCCAGAACCTTGTTAAACGTCTCGTTCACTGTGCGCAGCCTCGTGGCTGTGATAGTGGACGGCGGGCTACGTT
TTAAGAGCAGTAGGTTTTGGAGCGTTAAAACGATGGAATTCCGGCCTAAAAAGCTGCACAAACGTGAGGCAAGGCACCTACAGAGACGCAGTGTTGAGTG
ACTCCAGCAGTTTCGTCACTAGGAAGCGGTGCTcgtgcagcgccacctccacttcctcgCGGATGCTC