Description :
From Genome Similarity Track
Location :
Scaffold_5:907446- 908983
Transcript NameFunction/comments
g3001.t1hypothetical protein

Sequence
1537 bases(100 bases per row)
CACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACG
GCCAGAATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTTAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCG
ACTGCGCTGTAAAACAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGTTTCTGACGAGACTTGTCAGAAGGTGTGG
AGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCC
AACTGTGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGTGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAG
TTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGGGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGA
GTGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTT
CAGCTGACGCGATTGGTAGAAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACG
TGGAATGGGCGGTCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCC
ATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGTGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCG
CAGTTCCTTTACGTTTAAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACG
GGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGTGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCT
CCACATTCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCA
CCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGAATATCA
CTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTA
TCGGTGTCTGCGCCGGTACCGTCGCATCGTTCAGCTT