Description :
From Genome Similarity Track
Location :
contig_8:90732- 92199
Transcript NameFunction/comments
g1562.t1DAHP synthetase phospho-2-dehydro-3-deoxyheptonate aldolase

Sequence
1467 bases(100 bases per row)
AGATTCCTCCGGACTTTCTTATTGGTGAGGAAGTCCAATCTTCAGAACACCGAAACATGATGACGACGCGCTCGAGCAGCCAATGCACAACTCACCGCGA
TGATACACATTTACGCTAACCAGTGTTGAGGTTAGTTTTACTATGAATACGTAGCGTTATCGTGGCAAAAATGAAAACACGATCAATTTGTACCCCCTGG
CGTATAAATAAAACCCCGTTAATATGACCTTTGGATACTTTCAGTATCAATAATGGCTACATTCGTTACTTTGTCCGTCATATGCGGTCCACCATTTTAC
TGTTCCGGGGGTATAATTCACAAACTGCAACTGCCAGTGCCGCTTCATTTCTCAACTTGCCGTCTACCCACAAGTGAATCTTCAGCATTGTCAATGCCCA
GCCACAGTGAGCCCGAGACCAACCACGCCGCCAAGCGCCAGCGCCTGGAGGACCGCAACGTGCTGGCCATCAAACCGCTCGTGCCGCCCGCCTGCGTCCT
GGAGGAACTGCCCGTGACGCCGGAGGTGCACGACCTGGTGGACAAGACGCGCACGGACATCTCCCGCATCCTGCACGGTCAGGACGACCGCCTCGTGGTG
GTCGTGGGCCCGTGCTCCATCCACGACGTGGCTGCCGCCATGGACTACGCTGCGCGCCTCCAGTCGCTGGCCCAGGAGCTCGACGGCGAGCTGCTGGTCA
TCATGCGCACGTACTTCGAGAAGCCGCGCACGACCGTCGGCTGGAAGGGACTCATCAACGACCCGGACCTGGACCAGTCCTTCCGCATCAACAAGGGCAT
CCGCATCGCACGCAAATTGCTGTTGGACGTGAACGCGCTGGGGCTGCCCGTGAGTCTCGAGTTCTTGGACACCATCTCGCCGCAGTTCACGGCCGACCTG
GTGTCGTGGGGGGCTATTGGCGCTCGCACGACCGAGTCCCAGCTGCACCGTGAGCTCACGAGTGGCCTGTCCATGCCTGTGGGCTTCAAGAACGGCACCG
GCGGCAACCCCAAGGTGGCAGTGGACGCGGCCGTGGCGTCCTCACAGCCGCACAACTTCTTGGGTTGAACGAGCACGGACTCGCGTCCATTGTGCGCACC
AAGGGCAACAAGGACTGCCACGTGATTCTACGTGGAGGCTCGAGCGGCCCCAACTACGAGCAGAAGTTCATCGACGAGGCCGCCGAGATGCTCACCAAGG
CCAAGCAGCCGTCCAAGATCATGGTCGACTGCTCGCACGGCAACTCCCGCAAACTGCACGCCAACCAGCCCAAGGTGGCCAGCTACCTGGCGGGGATTGT
GGCGGAGGGCCACGCGAACGTGCTCGGGCTCATGATCGAGTCCAACATCGTGGAGGGCAACCAGTCGCTCGGCGACGACCCGTCCAAGCTCGTCTACGGC
AAGAGCATCACGGACGCCTGCATCAACTGGGACGACACGGTCACGGTGCTGAAGGAGCTTGCGGCTG