Description :
From Genome Similarity Track
Location :
Scaffold_93:9072- 13174
Transcript NameFunction/comments
Physo_141022reverse transcriptase

Sequence
4102 bases(100 bases per row)
TTGAATTCATACAGAAGCGCACCACAATTGAGCCTGGTCACTGGTAACCACTCAGGATCGTCGTATCCTTTCCACTTGATCAGGTACTCGCGGAATCTCT
TGGAAGTACGAGTGCGCTTGGCCCACCGGAGGTCCAGAATCTTTTCCACTTCGTACTCATCATTCTGTTCGTCCGGCTCCCAGCAGTCCTCGGGCAGCAG
GGCTGCATCGAAATCGTCGTCATCATCCAGTTCGAGTTCCGCGGTAGGTCGCTTCGGAAACAGAGCGCGAGGCTTGAGGCGGCAGATGTGTACCCAGGGG
TTAACACGATATCCTGCGTCCTCCACCTTGAGTTTCACTCTGAAGTCATCGTATACCTCTTCGATCATGAACGGCCCATGCCACATGTGAGCCAGCTTGC
GGCTCAATCCGGTCTGGACTTTCGGGATGTAGAGCCATACCGTATCACCCTTCTCAAATCCTGTCTTCAGCCTCTCGGACAATTCTCTCCACTTGCTTGT
CTGTTCTTCCGATCGTGTTCGCTTCGCTTGTCTCTGGAGGTCCTCGGCATAGGCTATTGCGTAGCTGTAGTCGCGCTGAAATTTCCGACGCCACTCGTAC
GCAGTGCGTTCAGGCACACTTGATGGTTTCGGTCCTAACATCGCCGACACCGTGCCTTGCGCATCCCAACCGTGTACCAGATAGAATGGAGTGTCCAATC
GGGTCGCGTCGAACGAGGTGTTGAGGGCGAACATCAGTCGCTCAGCGTGATCGTCCCAGTCAGACTGGTCAGACTCAGCGATGTAAGTGCGGACGCTCCG
GATGACGGTCTGCACCGAACGTTCCTGTTGGCCGTTCGCTTGAGGACGATATGCCAACGTGGCGCGCTGACGACTGCCGAGTAGCTCCCGAAACCGAGTG
AAGACCTCACTCATGAAACGTGGGTCTTGATCGTGTCTGATCATTGACGACGCACCGAAATTCCAGAAGACTCGCTCTTCATAGGCCTCTGCTACATCCT
GTGCCGTAGTAGACGACATGGGTTTACACATCACGTAACCAGAGAATGAATCCTGAAAAAGCAGTAGGAAGGTGTTCCCTCGTGCCGACTTGGGCATGTG
CGTCACAAAATCCATCGACACAACTTCAAACGGGCGCCTGGGCTCGATGTTACCAGGTGACGGTCCAGGGTTGGGAGGTCGCCCCTTTCCACTTGCACAG
TCAACGCACTCCTTCACGAAACGTTCCACGTCGGCACACATTCCGGGCCAGTAGAACTCGGAGCGTAACCGCTCGTGGGTGCGGGTAATTCCCTGGTGTC
CACCTTGAAAGTCCTCGTGAGCGTAATGCAGCAAGTCAGCGTGCAGGGTTTGTGGCACCACAAGACGTGGCTCATCCTGTACGTCCCGAGGTCGATCTCG
AGTAGACCGCGCGAGTCCATACAGGATGCCTCTGGCATCCAGTGCAAACAAGTCCGAGAGCTTCGCGATCTTGCGAAGCCGCCTCGGAGAGAATCGATCC
AGGTCGCCACTCAGATACGCTTTGACTTCCGAAATGAACTCATCCCGATCCTGGTGTGCCTTAATCCTGCGCCACCTCTCGGCTTGGAACTCCAACGGAC
CCAATGGGCCACTCGACTCTGTCTCCTCCTGTGTTCTCGATCAGGTCAGGACCGCCATGACTCGAGCACAGTGAGGTAACGGAGCAGAACCGGGGTCCTG
TTCGACATCGTCTGGTGACCCCACATCCGGTGTCACCACCTTCTTAGCAGCCGATCCATCTGGTGCATCCTGAACTCCCTCACTCACATCCTGCGCCACA
ACCACTGGCTTCATCAGCTTTTCGTGGATCTTTGACACTCGCTGCAGATGGATTCGTTCCTCTTCATCCTGTACAGTCCACGTGATACCCAGCGCCAGCG
TCTTGGAGGTCAGGTAGTCCGCGGCCGAATTGTATTCACGTTTCACATGAACGAGCCGAAGCGTACTGAATCGTCCTTCCAGAGTTTTGCACCGAGCCAG
ATGTCGTTGAAGGTTGGGTTGGTTGCAGTTAATCAGCTCTTGGACTTGTTGTATCACAATGCGAGAGTCTCCAACCACGGTCAGGTCTTGAACGCCCCGA
CCAGTGCCATGGTCAGTCCATTCAGTAAGCCGTGATATTCTGCATCGTTCACAGTGACATCACTCAGGATGAAACCTTGTGCATCGAGTACGCTCCAACA
AGGCAGGCTCCACAGGATGCATCCGCAGCTTCCTTGGCGAGTCGACGTCTTGGCTGCTCCATCGAAGCTTACCACAATCCCCTCAAAGTTAGCGTCCAAC
ATCTCCATGCTCACCACCGGTGGTGGCTTGACCCGCCCCTTGACTGGAATCAGCAACTCTGCGATCCGGTCCAAGTGCTCTCTGGGGGTGATACCCGCAC
CGAGTATAGTGGCTAGACCGTCTTCATCTCGCTGAATTCGGCGAACTTCCAGGTCCCACTGGGAAAGAGTGACGCCGCATGGTACGCAACGTCCATCCGC
CGACTTGGACTGAATCACCCACTTGAGTACCGAATAGCGGGTGTACACGATTATCGAACATCCTTCCAGGATCGTCCTGAATACATCCAGTACTCTCATG
ATCGCGATGACTTCCTTCTCCGCAACATGATATCGGACTTCCGAGTCATTCAGTACACGCCCCGTGAAACGGACGGGCTGAATCAGTCCGTCATGCTCTT
GACCGAGGACTGCACAGGCTGCCCACTGGTTCGCGTGAGGAATGATGACGAACGGCTTGGTCCGGTCCGAATGACGTAGCAATGGGGTCGACACGATCTT
TCGCTTCAGGATCTCGAACGCTTCCTTCGCCCTCGACAAGTCCCTACCGGATCGCACTTGGTCGTCGCTCAGCTCGTACAGGACTGCAGCTACCACCGGG
AAATCCTCTATGAACTTGTGGTAGTAGTTCAGACTGCCGAGGAAGGACTGGATCCCCATCAGAGTAGACGGGAATGGTAGATCCAGTACGCCCTTAGCGA
TCTTCGGCGTCGCCCGGAGTCCTTCTGCACTGATTTCATGAGAGAGATACGGGATCGAGCGCTTACCGAATTCACTCTTCGGTAGACTGACAGAGATGTT
CCAATACCGCAACCGAAACAGTAGCGCATCCAGATCGATGCAAAGTTGATCCCACGTAGGCGCCCCATGCGCGATGTCGTCAATGTACGAGCTCCGTCCT
AGGACAGGGCCCATCTGCATCGGCGCCGGGATGTTACGTTGGAACACAGTCATCTGGTCTGTCAGCGCGGGTAGACGTCGACCAGACAGGATTTCGTCGT
CCGATCCGGTGTCGCTCCCTGCGACGTTGTCCTCTTGCGGCTTAAAACCCAGATAATCCAGTACGTCCTGATCCACCTGAGCTTCCTTACCAGGTGGTAG
TCGAACAAAGCCCCACAGAGAGTTGTTGAGCATCTGCTGGTACACCAGCGGGGCATTCTTCAGACCAAATGGCATGCGTCGCCACTGGTAGTAACCGAAT
GGCGACACGAACGCCGAGATGAGCTTGGCTCGCTTCGTCATCCTGATCGCCCAGAAGCCGCTGGCCATGTCCAGACTCATAAACCACATCGCGCTCTCGA
ACCCGATTAGCAGGTCGTCAATGAGCGGGAGAGGGTAGTTGGACAACTGGATGAACCCGTCCACGATCCGGTAATCAATGCACATCCGGATGTCGACCCC
GTTCTTCTTCAGTACCATCACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTCTCCAACAACTTCTTCAGCAACTCGTACACCTTC
ATCGCAAGGTGTGGCGCGACCGAGCGTGCCCTCTGTGTGACAGGCTTAGCGTCTCCCACATCCAGATCGCAAACGACTCCGCGAGCTGGGGCAGGTGCCG
CATTTCCATCACCTAAGAAGATACTTCGGTGGTACCTCAGGATGCCACGTAATCGGTGTTCGTCATCCGGCGTGCTCACGCCAGGTTCGCCAACATCAGC
CTTGTCAATGTCGCACTCGGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGCAGATCGCTCCCTTCATGAATGTAC
AC