Description :
From Genome Similarity Track
Location :
Scaffold_130:90713- 91716
Transcript NameFunction/comments
g10244.t1ETI31888.1 CAMK protein kinase [Phytophthora parasitica P1569

Sequence
1003 bases(100 bases per row)
GGACGTGTGGTTCGTGACGACGCAGTACCCCAAGTATGGCGACCATCCTCCGTACGAGACTGTATCGCACCCGTCCGTGTCCAGCCACACGCGTCCGTAC
TCCATGCACGTGCCGTCCCTGTACCTGGTCTGGGACTCCAAGCGCGGGGTCATCGCTTTGCGTCGTCGCGAGCGTCAATTGGCCGTCAGTCGCTGCGGCT
TCGTGCTCGCCGGCGTCTACTTCCGCATGCACGAGGCTGCCGCGCTGCAGGTTCCCGTGGCCTTGAAGATCATGGACCGCGCGCAAGTGCTACTTCAGAG
AGACGACGTGGAGAGCGAGATCCGCGTCATGGGGCAGCTGCAGATGGGCGGCCTGGACGCCCCTTTAGCCAACGACCACATGATCCGCTGGGAGTACTCA
AGCGACGCCTACAACCAATACGTGGCCACAGAGTTCGTGGCCAATGGCAGTCTGCAGGCCTACGCACACCGTCAAGTGCACTACTTGATGTTTCAACATT
TACAGGACTTTGCACAGGAACACGGTGCGGCTCCGAGTAAATTAGAGTGTATTTCCTACGTCTATCGAGGCTCAGGTCACGAGTGGATGCGACAGAGTGT
GGAGATGTTTCAGGGATTGGTCAGGGCGCTCACGTACCTGCACGCGCAGAATGTGGCGCATCTCGACTTGGACGTGTACAATGTGGCAGTGGATGCTCGC
ACGTGTCCGAGGATCATTGACCTCGGCAGTAGTCAGATTATGGACAATCGAGGCTTGGTGGGCGAGGGCTACGTGAGCATCAAGTGCAAGCCGCTGTTCG
TGGCACCCGAAGTGAGGTCACACCAGAGGATGACGCCCCCTAGACCAGGGTTTAACGGCGCAGCGGCGGATATGTGGGCGGCTGGGGTGATTGTGAGTTG
TTAAAGGAGGAGTGGGGGGTTGAGCTGACGTGTTTTGTGTGTTATGTTGGTTTGTAGTTGGTGCAGTGCGTGGTGTGGGGATTTCGAGGAGGGCCGACGT
ACC