Description :
From Genome Similarity Track
Location :
Scaffold_97:9071- 16367
Transcript NameFunction/comments
Phyke_g4223hypothetical protein
Phyke_g4224kinesin heavy chain, putative
Phyke_g4225hypothetical protein PHYSODRAFT_286438

Sequence
7296 bases(100 bases per row)
TCCACAGCACACAACATGTTAGCACCACAGTGAATTTCCAATGTTGAAGGCAATGCACTCAGTAGTCCAGCATTCGATTCATTTTTCTTTCCATTTTGAT
CGTGTTTCCCCCTGTGGCAAAGTGACGTCCAGCCCGTCCTCTTTCCCATATAGAAAAATCAACGCTCTTTACATCCTCAAGCCTCTATGCCTCATCTTTT
CCCCTCTTAACGACGTCGAGATGTAGAGGGTACACGACTCAGCTTAGTATCGCAGCCAGTACGAGCGACGGCGGATGAAGTTGTAGTCCGGCAGCTCGTG
GATAGGGCCAGTCGCAGCCAGGGCGTGCTCCTTGTCATTGATGACCTCATCAGCCGTCTGGCGAACGGCAGCGGCGTCCACCGCGTCGATGCGCGCAAAG
ATCTCCGCGGGGGTCATACGGCGGCCGTAGGTCAACATCTGGCGACCAATGTCCTCGCAGATTGGACTCGAGCCGtccagctgcatcagcatGTTGGCCT
TCAGCTGCGTCTTAGCACGCTCAACCTCCTCATCGGTGGTCTTGTGAACAAGGCGCACCATCGCCTCCATCGTGTACCACGTCAGGTCGTTCAGCTTGTA
CTTGTCACCCACGGCGTACACACCGAAGAGACCAGTGTCCTGGTAGCACGTGTTGAAGGACATGTACGAGTGggccagctccttctccgcgATCACCTGG
CCAAGCTTTGACGACATGTTCATGCCAGCACCCGATGTACGGTCCCAGCTGCcgagcagcgtctgcatAATCAGCAGCGGGAATGAGTGTTCGCTGGTCC
AGCTGAAACCCTCGAAAGCAATGGCAACGTGAGCCAGGGGcatcttgtcgtccttgaCGCGAACGTCCGATCCTACGAAGCGCACGGGCTCAAGCGTAGG
GTCCACAGCAGGGGTCGTGGGGAGGTCGCCGAACGACTTCTGGgccagctccacgagctgcgAGTGGTCCACAGCGCCAGCGCCGGCAATGACCATGCGC
GGGGCCGTGTAGTGCGTCGCAATGTAGTCCTGCAGGTCCGACTTCTTCAGGTTGCGGATCTGTATCAAAAATTCACAAGCAAGCAATCGCATTAATCAGT
CAGAATTTCCATATCTACATACACCCAGGCTGACAGACGTACGTTCTCAATAGGGCCGAGGATCGTGCGGCCAAGACCGTTGCCCATGAAGGCGGTCTCG
TGGAGGCGGTCGAAGACGacctcctcctgctgcttgttcacctcctccatctcacGGAGAATCACGtcacgctcacgctcaaTGGCGCCCTCGTCCAGCT
TGGAGTTCTGCAGGATATCACTGAGGATGTCCATGGCACGAGGAACATCCTTCTTGAACACCTTGGCGTAGTACACCGTCTGCTCACGGCTCGTGTAGGC
GTTCAGGTGGCCGCCCATGTTCTCGATCTCgagctccagctgctgctgcgtgcgctTGCTCGTGCCCTTGAACGCCATGTGCTCCAAGAAGTGAGCAGCG
CCGTTGTTCTGCGCCGTCTCGTAGCGAGATCCGGCGCCGATCCAGACACCCACAGTTGCTGTCTCGCCGTGGGAGCCCTCGGACGCCACGCGAAGACCGC
TGGGCAGCGTCGTCACCTCCGTAGCGGGCGCATTCAGCACGTAGGACGGGTAGTTAGACacggcagcagccaccgacGATTGCGCGCGGGCGAGCGGCTG
GCGCACGAGGCTCAGCTTGGACATCATTTTGCCTGACTTTGGGGAACTCTTTGattgctgcgcttccagGCCACGAATGGGGAACACCACCGTAATGGCC
CCACGTTGAGAATTTTAGAAAATACCCAATAGATCAACCTCTTTCTCTAAATTTAGAGAGGTGGGGACAAAGACGCCTCCCCCCTTTTACAAACGTGAAG
CTCTCGGCCGTACAAAGACAACATACAAAATCTTTGATGCGAGAAAAAAGGCGATGGGAAGGTATATGGTAATTTCCAAATTAAAGTCTGTAGATGATAG
ATAACACGAAGAATGCAGTTGCAagcatcttctccttgtgttctggtggtgttgccaaATTGACGCAGAGTGAAATGGACGCATCGACTACAGATGCAAG
AGCAAGGAAGACCAGGCGTTGGGCAAGTCATGACAAAGTCCTTCACGCATAAGGTGTTCATTGCTCAATATTGGCCATGGATCTGACCAAACCGACTTGA
AATTCCTCAATGCAGCTCAAAACTACGAGTCCGCAAGCTTAGCTTTCGGCCAATGCTATAAGAAGCCCCACTGCAAAACATCACGGCTTATCAAACGCAT
TGAAGAGTATGTAGAAGAGTTCTGAGTTGAACGTGGCGCGCCTCGACAATACAGATACTACAAGTACAATGGATGCAGGCTGTATTTCTGAAACGAGGAA
GCCGAACCTGAATGTTGGAAGAGTCCGTGACTCGATAAAAATGAGTTGCCGTATTGCACCGGCAACACATGCATTAAATGGGTGCCCTGGTGAAGCAGCC
CTGGGGGCTTAGCAGCAGCCGAAGCATGAAAAGTGCACATACTGTGACTCACTTTCCGTCTGGTACCGGATCAGAATCAGATCAATGCTGACTAACCCCA
TTTTGGGATTTTGCTGCCGTCGCGATGGGGTCCGCTCCAGAAACCAGGGCTGGTATCCGTGTATGTGCGCGCTTCCGTCCGCAAAACAAACTAGAGCAGA
AACATCAAGCCACTGAGTGCGTACGACTGGAAGACAACACCGCCGCACATGTCCAGAACGACACACGTGGCGTCTCAGATCCCCACGTTTTTACTTTTGA
CCAAGTCTTCGGCACGGCTTCCTCACAGGTAAATAAACCTCCTACTGATGTGATTACAGTCTATGTATCATGCTTATTGTAACACTGCTCTGTTAATGGG
TGTAGCTAGATGTGTACAAGGCGACGGCGAAGCCCCTGGTGGAGTCGGCTCTGCGTGGCTACAATTGCACGTGCTTCGTGTATGGCCAGACGGGGTCTGG
CAAGACCTTCTCAATGGAAGGTGTGCCTGGAGATTCTGATTATGAAGGTATCATCCCACGCGTGATGGCGGACATCTTTGACGGCATCCAGAACATGCAG
GCAGAGCTCGAGTTCATCGTGCGCGTCTCGTACATTGAGATCTACATGGAGAAGATTCGTGACCTGCTCAAACCTTCTTCTACCAATTTGAATGTCCGTG
AAAATCGTGAGCGTGGTGTGTGGATTGCTGGAGCAACGGAGGTCTGCTGTGCGTCTGCGGAAGAAATGCTGTCTGTGATGCGCTTGGGTGGCGCGAACCG
TGTCATTTCGTCAACAAGAATGAACAGCGAGTCTAGTCGAAGCCACTCTGTGTTCATTATTACAATTGAACAGCGAAACACAGCCACGGGGTCATTAAAG
AGTGGAAAGCTGTTCCTAGTGGATCTTGCTGGCTCCGAGAAAGTTGGAAAGACCCACGCCAAAGGACAGACCCTgaaggaagcgcagcacaTCAACAAAT
CGCTGAGTGCGCTAGGTGGTGTCATGAACGCGCTAACCAGCGGACATGCCAACACTCATATCCCATATCGTGACTCCAAACTAACTCGTCTTTTGCAAGA
CTCGCTGGGAGGAAACTCGGAAACAACTCTGCTCGTATGTGCtagttccagcagctacaacagtGATGAAACCGTCTCAACACTGCGCTTTGGCACACGT
GCGAAGAATATTAAGAACAAGCCTAAGGTGAACGAAGAGCGAACAGTTGCTGAGTACAAGGTTCTTGTCGCGGAGAAAGACAAGCGTATTGCTACGTTGG
AggcgcttcttcacgaagctAAAGGCAGTGATGTCAATCAACCAACTGATCCgacagttgaagagcaacTGAAGATGTTCGCAGCAAAAGTGGAAGAACT
TGTAGACGACCAGGCATCGAAGGTAGCAGAAATATCTAGCCTGGAGGACCGGTGCATAGAACTTGAAGCTGACAACAAGGATCTTCAGGAAAAAGAGCGT
GAGGTTGCCTCTATCGCTAACCGGAACGAGGATGTTATGAAGAAATTGGCCTTTATGGAAAGTGAGCTGGCAGCGAAAGCAACAGAGTGCGTCGATTTGA
AGCAAATGTTGGAGAGACACCAAAACAAGGATACTCTGATCGATACACCCCCGCTTTCTACAGCGAGCACGGTGGATAGTGAAGTCTCTGTGAAGGCAAT
GGTTTCGGAAGAGAGCGTATCGGAAAGGTCGCGTGACAGCAAAGTACTCGATAACGAACTACTTCGCCAACAACTTGCTGCAAAGTCCCATGAGCTAGCC
ATTTGTACTCTGCGCGTCGACGAGTTGGCAAAGGAGTTGACAAGCTCCCGCAGCGAATATGACGCCCAAATCGTGGCGCTGCAGGACAAACTGCGTGAAT
ACGATTTCCACGTCCGCGGGTTTATGGACGCCTCAGAGCACGGCGACAGGGACTCGTTCATAACAAAAAGAAAGATGCTGCGCTCTGTTCGCGGAGGCAC
ACAGACCGCTGGACCAGGAAAGTTACAAGGTGTGTCGAGATTGAGTGCAACGGAGAATGTCCAGCTCCAAGATAATGTTGAAATTCCCGCTCATGATACT
GAGTGGAACCTGGATGACGAAGTGTTCCCGGTTGCACCGATCGATATGGAGTCTGAGGTCATCAAACGCTTGATCCGCAGCATGCCGGAGAGAGGTCGGG
AGAAAATTTCGAAATGGCTCGGATTTGTGCTTGAAGGACGTGATATCCGCTCGAATTTTCACCCCGAAATTTCGATCGAAGGCATCAATGACGATACTAA
TCGCGATATGAGGCGCTTGATCATTCCTCTCCTGAAGAACCGCCAAGATCTCAAGGTGCAGTCGTATGTGCGCACGCGATATGTACGCGTCTCTGACCTA
AAGATCGCCCTTGATCATAAACGCAAGAACGAGGTGCATCTTGAAGCTACTGACGCCGATGCAGCTAGTGACGACGGCGTAACGGAAGGCACAGGCAGCA
CAAGATTGGCCTTGCAGTGGGCCAAGGACCATCTTTTCTACGGGCCAAAGAGCGACGCTTCCAGCCCTTCAGTGCTGCACGCGAGCCGGCTGCTAGCTTC
GTCGAAAGACCGCTTCACATCCGAGCCTATCGACATTAGCGCCAGTATGATAGAATCCAAGGCTATGCTGAACGCGGCCTCCGGAGCTATGACTCTAAAT
CGTAAACCATCGCTTCCTTTCGACACGCCCAGTCCTTCGGGGCCCAGCTCAGGTGGCAGTGGTATGCTTGGTCGACTTCGGTCCAAGACGAACGTGGGAT
CGATGATTGGCGACGTCAAGAGCAGAATCAGCGTACGATACCACAAAAAACATGTCCACGAAAATGCGCTGTGTGACGGCTGTGGTACAAGTCCTATCGT
CGGTGGGAAGTGGAACTGCAACACGTGTGAGAATTACGATCTGTGCGATGGCTGCtatgctgctggagttcaTGGCTTCGAGGTCAGCAATGAGATGTGC
CGCCGCGTTGAGCAGCTTGCGGTGCAAAAACACCGTCTGCTAGGTGAGTACCCGGAGCtttttgagctgcttcgccGGCATATTTGCAATGACAACGTCA
TCCAGTTCCGTCGCATCGTGAAATGGCTCTGTGCAATTGTGTCTGGAGCTCGCTCAAGCAGCATCTACCACAAGATGATCGTGAAGAGTGGTCTGCACCC
AGAGATTCGAGCTCGGCTTGTAGCACAGCTTGGTGCCCTGGCAAGCTCGCGCGCCAACATATCATTGAAAACAGAATGGTTTCCCGAGAAACTCaccgac
gaagaagaagcagattcAGACGACAGCCAAGACTTCGACTTGACGGATACGCCAGTAGAGTTGGACGGCGACAAGTTGTCACCTACGAAAACTTTCTCCC
CAGCTGATGTtcaactggagacgctgcgcATGTATCTGACGGATGCTTCTACCTCGTCTAAAAGAAGGAACCAGCTTACCCCACCAGCATCGCTATCGGA
TCTGCTAGATCCATCAGCAAAGTACCCAACAGGCAGTCCCGCTAACGCTGAGATGAGGCGAACCATGAGCCCCAGAGGGAAATCTGCAGACGGTAACGGC
GGACGACCCGCTGACATGCAGCGCCAGCGGTCACTCGACCTGTCATCGAATGGGCGATTGCGAGTCAAAACCATCGCACAGCTGAATCTGTGAGCAAGTC
TCCGGCATAGTCCAAGTCTTGCATGACCCCTCCGATGCGTGACGAGGCAGTCTTATCTTAGCATTCAAAGTTGAGTAAAAATTAATGACGTGCAGAAATG
CTTTCATGTGACGCGGCAACACGTGGACCACCAGGATTGGCTTCATGAACTCACACACCGCTTAGATCAATCTACCATGTAGATGGCGCCATGCAAGCTG
CCAAGATTCTTGGCAGTCTTCTTGGTCTAAGAAAGTTTCCTCAGTTTTGCCACGCAAAGATATCATGCATTGCGAGCACGTTTCAAATCATCCGGTCAAG
TTCTTTCTGCTTCGTTTCTAGGGAGAGAGATGCGGCACTTCAGATCTcgaccaagcagctcgtTTCCACGACGCCATCAACGAACCTgcacacgaagcag
cacaactAGCACTTGATCGCTCGTCCACTGCTGCTAACATGATACTTACAACATGCCAACCGTGCGTCTTACTACTGTAACAAGCTATACAGCTTTAGCC
TCCAACACATGTAATAGAAAAACATTTACTACTGTAGTAGCCTTTTGCCTCTTTGCCTCTGTGCACTTCACTCTCCAGGGGAAAACGAATCTCCACGTGC
AAAAATACTCTGGTGCCGTTCACTTGAAGCGTCAGCAGACGACGGACGAGGATCATCTTGGGGCACTCACTCACTTAAGGGCTGGTCTTACTGAACTCCG
CCACTTAAGGGCTGGCCTTACTGCATTCCGCCACAAactggcgctgctgcgtggacAATCCCCAGACGGGCGCTCCCCGCACGAGCAAGCGACGGATGAG
CGAGTCCTGCTCGCTGGCAAGACGCgccagcgccttcttctgctcctcagcagccagcgACGTCTTCTGGGCCTCCCACTGCTTCatgagcttctgcagc
tgcgtcagGTCCTGCGGCTCGGCGCGCGAGCCAGGGTTGAACTTGGATCCAGCCTCCGAGCGGGTCTTTGCCGAGCCGTAGAAGCCTCCCTGGCCCTCGG
AGGGCTGGCCGCCAGAGTACGTGGTGAAGGCAGCCGCAGAGCGTACGTGgccagcagcggcagcgcgGGTGCAGGTCTTGAGCATGGCAGATTGCA