Description :
From Genome Similarity Track
Location :
Scaffold_323:9071- 14014
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_323-snap-gene-0.14Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_323-snap-gene-0.15Conserved gene of unknown function

Sequence
4943 bases(100 bases per row)
GCTTCGTCGTCATTTGACAGGATTGTTGTCGAGGACGAACCGAATCGGAACCCGAATTGCGCGAGCGAGATGCCCGCGTTCTCGTCAAAAGTGTCCAAGA
GCACGCGCAGTGCACGGTCCACGGTGCTCAGCGACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCGTACACAGCACTCTTCTGAACGAGCCAGTACACGACGCGGATGAGCAGAAGACGTGCGTCTTCGTCGCTTTCATGATCGCC
TGAGGCTCGCGCTACCAANNNNNNNNNNTGGGTGCTCGGTGATCGCGCTCAAGTGGTCGGCAAAGCTGTAGGTCGTCACCGCTGCATCGACGCTCGTCGC
GAGCTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTACGC
CGCCATGGACGCGTAGTCGTAGTCCTGGGCACGCGTCAATTGAGGCCCAAGCTTCTTCAGCAGCGCAATCGGGTTCACCGTGGTGACGCTGCTACGCACT
AGGTCGCCGACGATCGTNNNNNNNNNNGCGTCCTTGTCGTCGGATTTAGATTTCGAAGACTTGGTGAGCGATTGAAGAGCGCATTTCACAAGGAGCACGA
CGGCCGCATCGGCTGCTCCCTTGCTCATCGCGTGAGGCGGGCTGCTGGAGGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTAACAGTAGCAGTGAACTCAGTTGGCTGGACGAGAGGATCGTGCCGTCTGGGAAGCGCTTGACGAGCGTCTGGAACACGGTCGACGCGACATT
GGCGAGCAACCCATCGTGGTCCAGTAACGCATGCCGCACGAACGAAAGCCTGGTACGGTTGGTGCCGTCCTCGATTTCGCTAGTGATCAATGCTTTGAGT
GTCTCTGGGGCCAACGAGCTCGCGTGTTTCGCCAATTCTGGGGATTCGATGCGCGTAAGCACGCTGAATACCGCTGTGAGAAGCACCATCGACCGCGTTT
TCTCCTCAGTAGGCAGCTTGGCTGCCAGTACGGACTCCAAGGTCGCCACGAACGTGGCCATGGCGCGCAACGACGCCGCGTCATCTTCACTGCGCACCGA
GAGCACAACGCGTCGCAGCAACTCGGTCGTCGTGGACAAACGGTTGTTGCCCGATGCTGCCGCGTGCATGAGAACAGGGATAATGGTGCGTTCTACCGCG
TTTTGCGCAACTGTGGCGTCAACGCCACCAAGTTTGCCGACGATCGAAAAGCCCGACGCGAAGAACGAAGGCATCGAGGCTCTTTGTCGCAAGGACGGCA
AAAACAGCGGTGCTGCTGCACGCTCCAGCAGATCCCAGACGCGTCTAGCGAGTAACTTGCGTTTCTTGTACGCAGCAAAGGATGCGTACGTTGTTGTCGT
CATGCTGCTGTCTGAGTCCAGCGACTTCAGCAAATGCTGCACGAGCACGCTCTGAACCGAACGCGTTTGCTTGCTGCTGCTGAACGCGTGCAGCAACCGA
ATACGCAGCGCCACTGGCAGTAGCGGCGAGAGCAGCAGCACGGACGGGATGCCCGCACGTGGGAGTAGCAACTCCGCCCATGAGGACACCGAAGCAGTAG
ATCCTCGCGTCGTGTCAAGCAGTCGCAAGCCTGTGATCTCGAGCGCAGACAGTTTGTTGTTGGGCTTCTTGTGTTGGCCCACTGGGTCCGCGATCGCGTG
CAACTTGCGGAAAATGCGCTCGATCTGGAAACGCGCGAGCGCATTTCCATCCAAGTCGTTGGCCGTTGAGACGACCAAGAAGCTCAGCACATGGAGCAGC
AGTGTAGAGAGACCGTCGTTGTCGTTAGTACCGCTAATGGACAACGAGTAGCGCAGTGCGAAGAGCAACAGATCACAGATTCGCACGGCTTCGGTCGTCT
CCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACGCGCTGCTTCACGATACGCAACAACGTCGAAGTGACATTGTCCCTTTGGCGT
AAGCTGCTTGAGCACAGCAGCACACTCTGTACGACGAGCCGCAAGGGCAACTCGGCCAAGAAGCGTCGACTGACCTTGTTGCTGCTGGCGGAGCTAAACA
AATCTAGCAGCGAGTGGTTGTTGTCGCTGTCACCGCCGACCCAGGAACCGATGTAGTGGACTACAAGGTCAAAGGAGCCCGTGACATCCATGGAGTTGGC
GACAATTTGCTCCCATGAGGCCACAAACGCTGCTGGGGTCGCCGAAACCAGTTGCGACGCGAACGAACGGCGGGATTTCGCGAAGCTCCACGACGCCACA
CTTGTCTTTTGCTTCTTCTTCTTCGTGTCGTCTAGAGACGACGACTTGGCTTTNNNNNNNNNNNNNNNNNNNNNNNNNCACGCGATTGCACCGAAGGACT
CGCTGGCGCTGTGAGCGCGTTGCAGTACTCCACGAGATGCGTGTACGTGTCCCTGTTAGATTCAGGCATGTTGTCATTGTCCCCACGTTTCCGCTTGGTC
GCTACTGGGCCTTCTTCTTCTTTCTTCACGTCATCACTCGCGCTAGCACTTGAGGTGATCAACGAGACCAACTGCTGAGGCGCTTCAATCGACGGGAGCA
GCGAGAGCAGGATGCGCGTCCCAAACACGACGACGTCCGGGTTCGAACGGTGCGCAGCCAGTGGATTCGAGTTTGTTGTCGACGGTTGCTTGCTTAGGAA
CGACACGAGCGCGATCGTACCTGGGCTGAGCGACAGCGGCTGCTGGTGATTGCCAGCGCGCGCATGGTATGTGGCCAAGAACTGGAACGGATCTGCAAGC
GCGTTTTGCACGAGGCGTTCGAAGAACGCAGCGCACGTGGCGCCGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
CTGCTCCCTGGCAGTGATGTCGGTGCCAAAGACCGTGGAAATCGACAGCGTGCGGTGCAGCACGTGGCCACAGAGGTTGCGAATAGCTACGTTCGGAGTT
TCCACGTACAAATGAAGCAACTGGAGCAGCTTGGAGCTACTGGCATTGTTGTTGCTTGAGGCACCACCACTTGGCAACAGCACTTGAAGACGGTTGGCGT
CGACCGTGAGCAGAAAGCGGAGGACCTCACTCACAATCAGACTCTGGAGTCGCGAGCTCGAACTGGAAGACGACGTGGCAGGATCCACGTGGCTCCACGC
GAGGATCTTGGTGAAATCGAGCTTCACTTCGCTCATGACCTGCGGGAGGCACTCCAGGTACAGACGGAAGACCACGAGCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGATGAGCGCGACCTTGTCCACCGACGCGCACAACTTCAGCAGTAGCGACACGAGCGCCTCAGGACTCGGCAGCAAGAAGCGGAGCTCCG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCGTGACCTCCATGATCCCGAGCGTGCTGTA
GATGATCAGGTTGTTGGTGTGCTGGATGCCGCGCGACAGCTCCTTGCGGCAGTTGATCGGCAAGATCAGTCGCGTCGCGAGCGTCGACGACNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCGGAAGTCCAGGCTTCACGGCGTCGAGCGAGCACGAGAGCAGTTTT
TGCACGAGCGACGCGACGCAGAACCACCGGTACACAGGCTTGGGCTCCAACTGGATCGACGCCGCGTGCAGGTACTCAGCGAGCAGCCCTGGGTACTTGG
TGACAAACGATGCGATGAGCGCCTGCGCGTACGCGCTGTGGATGTACTCGTTGACACCAATCGTGACGATCGCATTGCGGATCACCTTGACGGCGTACGC
CTGCTCCGACGTATGGCTCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGTGTCATCGTCGAAAAAGAGCGCGTTGAGCACATCAAGCGCCATCTGCGCGATGCTCTCGTCCTCGGACTGAAGCAGCNNNNNNNNN
NTACGCAGTGGGCGTTGAAGATCACGAGCTTGGCCTTCGTCTCAACGCTTGCGTTGCGCAGCACGAGCTCCTTGAGCTTTGAGAAAAGCTGCGAGAGCAT
CTCAACGCTGTCACTGTCGATGGCCTTGAACAGCGACGCCGTGAGGCCGCCCTCTTTCATCGCGAACCGATGCACGCTCTTGTCGGGACACGCCGTCAGC
GCTAGCACGAGCCGCACATACGCCTCTCGGACCTGGAACGCCGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTTTCGCAAACGACGGGCTCTGGAAGTTGAACAGCCGCACAAACTCGCGCGCTA
CAGCGCCATTGACGCCCACGAGCGCAGTCATAAGCTCCAGCGCCTCGTACTCGATCAGCGGCTTGTCGTTCCACGTGAGCACTTTCTCCAAGTGCGTGTT
CTTGTCGCGGATCACCTTGAGCGCGATGGCCTCGGCGGNNNNNNNNNNCATTGCGCTGCACCTGCACGCGCAGCAGCAGTGTGAGCACTCGGAAGAACGT
GGCAATCGAGTCGCGTTTTTCCCAGNNNNNNNNNNNNNGCCGGCGCCGTGCTGGTCGGGCCACACGTGGAAGAACACGTCGCCCTGCGGGTGGATCTCCA
GGAACTTGGTCGCCAACAGAAGCTGCTGCGCAGAGGCGCTGGC