Description :
From Genome Similarity Track
Location :
Scaffold_82:90690- 92201
Sequence
1511 bases(100 bases per row)
AAGGGATGTGNNNNNNNNNNACACGTTTCATCACTGCTATCGATGTGCCTGTTGCGAGGCGCACCGTCAGCCTCGTAGGGGGAGTAACGCACTCAACGAA
CTTGAGCCTACGATCCTCTAGCGACTGGTGACGAACTAAGTTGTTTGCCGCCCGATAGGCAACTAAGGCACGAAGTGACAAATCTTTTGTCACTTCTAAA
TTCAAGGTGATGTGGGGTACCTCATCACCAAGTGCAGAGACACACAAGGATTGTGAGTCTGGAGTAACTTTCATCAATACATTTGCAAATTCTATTGAGT
TAGCTGAGTCAGTAGGGCGCTCCGCCCCTACTGACCCCGACCGTTTTTGACGGTCCACTAAGCTGTAGTGACTTCGCAACAGCGTCGGACCTGCGTCCGT
TGCCCTTCTTGGCAGGCGGTCGATCACTTCTCTTAGTGTTACGAGACACTGGGCGTGAAGCACTACAATCGTGGGCGTAGTGTCCTAACTTCTGACAGCG
ATTTTGCACTTTTGCAATCGCTTACTTCTTGAAGAGCGAGGTATCTCGCTCTCAACACTGCAGAGGTCCGTTGGTTCTGGACCTCCCGCCTCTACTCGTC
TCGAAGGACGATAGGGGGTCAAGCTAGTGTGAGCCTGACTCACACTAAAGTCCTCTTGCACCGCAGTTGTGATCGCTTCCTCAAGCGACTTCAACTCGAT
GCGGAATAGGTGGTTCCCCGCATGACCATCTATAAGGCCCTGTAAGAATATCGTGATCAACACGAGTTCACTTACAGGGTTCGCTACCATGCAACTTGCA
AGGTATCGAACGTGTTGAGCGTAAGCGTGAACGTCACGCTTACCTTTTTACCTTCAGGAGCTCTGTTGGAGTCCTGAACTCAGTTCTTGGCGGCTCAAAC
GTTTGGCTGAGCAGAGTTTTAAAGACCGCCAACTATCCAAAAACGTTTGGATCGTGTAATTGAAGATTTAGGGCCCAAGTTCTGGCACACCCTGACACAG
TCGATTTGGCAAATGCAACTTGGATTTCCTCGTTGTCGATGTGGCGAGCCTTCATGGCATCGTCCACTTCGAGGAACCATCTCAACAGGGAGTCTTCCTT
GGTTCCCCGGTACTTGGAGACTTCTAACTTCAAAGTCTCGCGTCGACGCTCACGTGTCGACGCTGCAGTAGAAGACTGAGACTGTTGCTGTCTCAGGAGC
TCAGTCTGCTGGTGACCGTGCTGATGCAGCAGGGTCACTTCAGCTCGCGACGCGTCAAGTTCTCGCTGCAAGAACTTGGCGATTATGGAATGCTGTTGGT
TCCTATCCCTTGAGCATAGCAGAGACTAGACAGCTTCTTCGTCAACGGTCGAGCTCATTCGTTCGACCGCACTCCATTCGACATCACTCAAATAGGAGTG
ACTTTCACGGGTGCCGTGAAAGGTGTCGTCGCCTTCGTCGTCCAACATGTTCATGTTGAACGGGTATTGTGGTCCTTCGACGGACTACAAAGTGCTACCA
GGTGTAGCGGG