Description :
From Genome Similarity Track
Location :
scaffold_75:9068- 10897
Transcript NameFunction/comments
g2839.t1hypothetical protein

Sequence
1829 bases(100 bases per row)
TCCAAGAGGTTTGGGACTGGGCTGCTTGTCTTCGGGAGTGTCATCACTCTTCAATGTAGCAGAGCTGGAAGAATCAATTACCAAAGCCTCTTCCTCAACT
TTAGCTGGCTCTGGACTAGGCGGACTTGGATCAGAACTTGAATTGTTGTTGTCTTGATCGTCATGGTCTTCTCCAAGTAACTCGTCGTACTGTTGGCAAA
GTGTCGCCAGCATACTACGTTGTGGTAATGCGCTTGTACTGATACTCGTCGCAAGAACAGATTCACTCTGCTTAGATTTGACTTTCGGGCAGTCAGGTAA
AGCAGTCAAGGAGTGAGCCCTCGCCAGTGCTGCAATTCGCTTCGGACGTGGCGGCTTTTTGTTCAATCTCCGCGCTCGTTTTGGCTCTAGATCCTGCACA
TTTTCACGGATAATACAACTCACACCGAGTTTCTCCAGTAGAAAAGCGGACGGTGTCAAGTCCATCGTTGCTAACGAGTTTTCCAGTCGTCTTTGACGTA
AAAGCCCACTGCTTCCTGCGATCTGCTTGTTACTTCGACGAATATTTTCTCGATGGAAGTGCTCGTACATTTGCTTCTCCCTGTTCATACTCCCCACTGC
CCAGTTGTCTTTATCGGCGAACGGGAGCTCTTGAACGGGGTTCTGCAGCTCCGGTAAGAGCATTTCTGAATCGGCATCACTGGCTCCCAGAACCTCGAGC
TTTCCAAGCGAATCATTGACTCCTCCATGGTTAGAACCTGCCTCCTGCTGTTGATTGCCTTTAGATCCATTTTTCTGCTCTTCTTCCTTTCTCTTCTTGG
CTTTCTGCCGCATGATCAGCTTCATTCGCTGCTGAAACTTCACTCGCTCCTTCTCCCAAGCTTCTTGCCTTGCCAGTTGAAGATCGCTCTTCTTCCACGT
CGTTTTACCTTGTAACTGGTCAAATAGCCGTCGTGTGTGCTCCACCACTACGTCATTTTCTTCTTCAGTAGGAATTACCTCTTCAGAATTAACTTCCTTT
TGAGGAACTTGCTCAATGACACTCATTGAAACACTAGTAGCCATTTCTTGAGTACTGGAACTTCGTGAGGACTGGCTAATTACCGGAACACTCACACTGT
TGCGCATCGTACTGAGCTTCCGAGTTCTGTTGGCAACAGCAATAGACTGTTGTTTCAACGCTACAGCCTTGAGCTTCGTCCCTTTCAATTCGTCCCAGAT
TTCCTCTGCTTGTCTCCGTTTCAACGCTGCTGCACTCGTAACATCAACTTCCCATTGCCAACTTTCCACTGCAGACGTTGTCACTGCTTCCATTTGTGGG
GCTGTAGGCGTGACTCCCGTAGCTAAACTCCCTCTCTGTCGCCCTTGAAAGTCCCAAACGTACACTCCTTTGTCGCTTCCGCAGGTTAAAATACCTCGAG
GCTCAGCTACGATCTGCAAACACCTGACATTACCACGATGAGCAGTCCATCGATGTGTACAGACCACGTCGGATTCGTACACGTGAAGCTGTTTAGGCTC
TGGATGCGCTAAATTGTTATCAGCATGCTTGTTTCGAAGCCTTCTAGCGTTTTTCCCTTGTCTAAGGAAGCGTCGACGTGGGTTGTACGCTCTATCGTGA
CGTGAAGGCATGTTTTCCTCTTTGAAAGCTCGGACGTGGGCAGCAGTGATGACTTTAGAGATATCACAGACTATCACTTCTCCATAGAAACTCGACACGA
ACAATAGGAATCTACCACGATCGATCCCTGCAGCCAATTGTTCTCCTCCAGTTTCATCGTAAAATGTCCGACAGCAAGTGACTGCACTGTTGAGCTTTAC
GACGGTTAGTGGGGAGTGAGAAGGAGGTA