Description :
From Genome Similarity Track
Location :
Scaffold_301:90648- 94841
Sequence
4193 bases(100 bases per row)
ACAGCCACCCTCGCACGCTATCCCCAGAGAGCCTGCTGACTGAATCCATTCTGTCAAAGGTGCCGCGGACGCGAGGCCTGAGAACACTGAAACGCCTCCG
CCTGATCCGGACCGTGACCCCGAGGAAGAGTTGGAAGTCGACTTGGAGAGCTCTAAGCTCGGAGACGAGCAGAAAGAACTGTTCCGCGAAGTTTTGCAAC
CGTTCAAGGACATGATCACTGAGACCTCTATGCGACCAGGTCGTACTGATTTGCTGGAATTCTCGATCGACACGGGCGACCACGCGCCGATTAAACAACC
TCCTTACCGAGTGTCCAAGGCCGAGGGCGACGTCATGGAATCCGAGATCCAAGAATACTTGAGTCAGGACCTCATACGACCGTCTACCAGTCCGTGGGCC
AGCCCAGTTCTGATGATCCGCAAGCCTGACGGAGGGATACGGTTCTGTATTGACTACCGAAGGTTGAACGCTGTCACCATCAAGGACTGTTACCCCATGC
TCCTTATAGACGATATCCTGGACGTTTTAGGGAACGCCAAACTGTTCTCAACTATGGATATTGCCTCTGGATATTGGAACGTCCCTATGGCTGCTGATAG
TGTGGAGAAAACAGCTTTTACTTGTAAGTACGGACTGTTCGAATGGCTGGTGATGCCCTTCGGACTGTGCAATGCTGTTCCGGCCTTCGAGCGTCTAATG
GAGACGGTTCTGGTGGATCTCAAGTGGAGAACATGTCTGGTGTACCTCGATGACTGTGTGGTTTTCAGCGAAGACTTTCCTACTCACTTAGTACGGCTAA
AGCAAGTACTGGAACGATTCCGATCAGCTGGATTCAAGCTCAAGATGAAAAAGTGCAAGTGGGCCCGGGACCAAGTGGCGTTCCTGGGACACATCGTCAC
TCCTTCGGGCATCCTGCCCAACCCTGAAAAGGTGAAATCAGTGATGCACGTCCAGAGACCTCACGATCTGCATACGGTTCGAGCGTTCCTGGGCCTGACG
AGCTACTTCAGACGCTACATTGCTGGGTACGCTGCGATTTCGGCTCCGATCGAACGCTTGAAGATGAAGGGAGCTCAATTCGTCTGGACCGAAGACTGTG
AATCAGCATTCCTACAACTGAAACGCAAACTGGTGGAACCTCCTATCCTAGTGTATCCTGACTTCTCGAAACGCTTCCAGCTGTATGTGGACTCCTCGAA
GCTAGCAGTTGGAGCGTGCTTGATGCAGACTGTCGATGGGCGAGAGCGAGTGGTGGCGTACGCTTCTAAGTTGCTAGTAGGATCCGAGAAGAGCTGGATT
CGCAAGGAGGACGGCACCTCGGAGATTGAATGCTGGGGAATTGTCTGGGCCACTCGAAAGTTCCGCTGCTATTTGGACCGATGTGAACTCGACCTGTATA
CCGATCACAAGGCGTTGACCTGGGTTTTCAACGAGACCAACCGTACTAGTAACGCTAAACTGGGCAAGGTGGGCGATGGAGCTGTCTCAACTGCGTTTCA
AGGTGTTCCACAAGCCTGGGACTTCCATGGGTCACGTGACGGTCTATCTCGGCTTCACTCTCAAACGATCAGTGCTATGTCGAAGTCAGATACATCTTTA
ACGAATGCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATATTATGAGCGT
CTTATGATTTTCTTCCTCTCGCGACTTCCATGTCTTTTCGATGTTTGATAGCTGTACCGGCACAGTAGTGCAAATGCCTACATACGTATTTAATACTATG
AAGTATTATTTACTACATGTACAGCTTTCATGTCATCGAAAAGCATTATACGCTCATATTATGATGTACACTGTACTTTAATACTACATGTATTAGAATA
CCTGTAGTACTGGCCGATTGTCTACATTGGAAGAAGGATGTAGCTGAGTACGTTCGGGAGTGTACTGTCTGTGGAAGTGGTAAAGGTTATCGACCGTGGA
AGAATGGTCTCATGCAGAAGATGCCTGTGCAAGAGTTATCCGGACCGTTCTCCTTGTTGGTCGTTGATGCTGTAGGCCCCTTGGTGGCTACTCCTAGAGG
TAACAAGTTCATTCTGGTCTTCGCGGACTACTTTACTAGGTGGGTGGAGGCGTTCCCGGTGGCTCGGCTTGATACGGTGACGTTCGTGGAAGTGATGGTG
AACGAAGTGATCTCCCGCCATGGTGTTCCTGAGCGGCTGCTCAGTGACCAAGGTTCCAACTTCATCTCGGGATTGGCTCGCTCTTTCTACGAGACTCTCG
GAATCAAGAAGCTGTTTGGCGCTGCCTATCATCCTCAGACGCAAGGACTGGTAGAGCGTTTTAATGGTACGCTCTTGGGAATGTTACGAATGTACGTCAA
CGAGTCGCAGACCGACTGGGATTTGTACTTGCCGCGGGTACTTTTTGCTTACCGTACTTCCTATCATGAGGCGTTGAGGGACTCGCCCTTCTTCAGTCTC
TATGGTAGAGACCCTGTATTGCCTCTGGATCTAGCGTTCCTCAATACGAACAACGAGTGGAAGAGCAACGAGGTCGCTAGCTATCGTCGGAAACTGTTCT
TGTCTTTCCGTGACACTAGACGCATGGTAGAACGCCAACTTCTGAAAGCTCAAGGTCGGCACGAACAACGTTTGGGCAGTCAAGTGTCAGTGAAGTTCGC
AGAAGGCGACCCGGTGTGGGTGTACCAGTATTTCAGGGCTCGACGTGGCGAACGAACGACCAAGAAGCTAGCCTTCTCGTGGCATGGTCCCTATCGTGTG
GTGGGAACAGTGGGTGAAAACGCTTATCGTATAGCCATTCCTACCCATCCAAACCGAGTGGTGACCCTCAATGTCAACCGCTTGAAGCGTTTCCGTGGAC
GCTGGAGTAGACCGTTCCCGTCTGAAGTGCCGGAGGGAGTACTGACCAACCCCAGCTTGGATGACGACGGTCCTTTGACCGAAGATGATCTCCCTTCCAC
TAGCTACGTGGAAAGACTGCTCATTGGTGGTGAGGAGACGGCTTTGACAGGCGTACCTTGCCCAGTGATAGACATCGTTGCGAGACGCAATAAAAATCGA
GAGGAACAGTTCCTAGTGTTATTGGCGACTTACGAGACTTTATGGAGACCAAGAAATACTCTACTGCCTACTTACGCCGCTCTAATTAAAGCGTTCGAAG
ACACGAGAAGGAAGAAGGCTGGGCTTCCGGAACTTCGCCGCAGCGCGCGCCTGGAAGAAGCTAACGCCGCTGTGGACGAAGATGAACTACTCTTCTAAAG
AGTAGTGGAGTGAGATTAGCCTTTCGAGTCACGGTGGACTCTAAAGTCAGTCTTGATGGGGAGTGTGCAGTGAAACACTTCCTACTTTTACTTTGCATAT
TTCTGGATATTACGAAGCGGTTTCAAGCCTCATGCATTACGAAGAGAGACCAACAAGTCATCGGGCGCGAGATGAACTCTACAAGAGGCTTGTTGAAAGA
AAAACAAAACGAAAAATTAGTTATGAAACGACACTACTTCCCCTACCCGCTTCTAATTGGAACGGTCTGGATCACTGCGGGCGTGGGAAAGGAACGCTGG
ACAGCGTGACTACGCTGACTTCTTCGACGGTGGCGACTTGGACGACGAACGGTCCGGAGACACCGTAGCCTTCTTAAGCAAAGGTGAAGGCGACTCGGCA
CGCTCCTCAGGATCCTCGGACTTCTTCTTGGTGGCCGACGGAGCTTCCGCTGCTGGCTCGTCTGGCGACTCATCGGGCTTCTTCGTCTCAGGAGGCGGAG
AGAGTGAACGGAGAGAGGAACGCTTCGGAGACGAAACCTTCTTTGTCTCTTTCGCAAACGACGAACGCGAAGCTGAACGCCGACGCGAGACTC