Description :
From Genome Similarity Track
Location :
Scaffold_254:9063- 21105
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_254-snap-gene-0.20Zinc finger (CHY type) protein
Pytar_ATCC12531maker-par_contig_254-fgenesh-gene-0.1Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_254-fgenesh-gene-0.8Endomembrane protein 70
Pytar_ATCC12531maker-par_contig_254-fgenesh-gene-0.2Karyopherin
Pytar_ATCC12531maker-par_contig_254-fgenesh-gene-0.9Dihydropteridine reductase

Sequence
12042 bases(100 bases per row)
GCGCTGCTTGCCCAGGACGCCGACGCGCTTGTGCTTCTGGCTCTCAGTCTTGTTGAGTCCGCGGAACTTTTGCTTGTCGTTGGCCGCCATTTTCGTGGCG
TCGCGGCAGCCGGTGCCGCCCTCCCAATGGCGCGAGCGGGTCGTGTGTTTGCCCATCGCGTTGCCGCACGCGCATTCCTTGACGGCGCTCGACTGCTCCT
TGGCGCAGAAGCCGCAGATGATCTTGCTCGCGATCTTGCCCGTGTTGGCGGACTCGCAGTCGGACGCGTCGTGGCACACGTCGCATGGGAACGCCTTGCC
GCAGCATTGGAAGCGGAACCACCGATGCGAGTGCTTGTAATGATCACACGCACCGTTGCGTGGCAGTGGCTGGCCCAATACAAACGTGTCGACCACGCGC
CTGGCCTTCTTGGAGGTCGAGGAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCCCCAACGTCGCTCGTGCCGACCGCGACGCGTT
TGGTCTGCATCGCGAGTTTGGTGTGGCAGGAGAAGCAGGCCTGCTCCGCCCGGCGGCCCGGCACGATCTTTTCCAGCAGCGCCTCGCGACCGCACTCGAG
ACAAGACGCCAGTACGTCACTGGGCAGCACATCGACGACGGCGCAATTTTCAGTGTCGATGTACGCGAGCACGTGGCTCTGCGCGTGCGTGAACAGCGGA
CGCAGCGACGCGACGTGCTTGACGCTGCACCGCGGACACCACTTTTGGAGAGCGGCATGCTCCCGATCGAGCGTGAGCGTGGCATCAAACTTGAGCGGAC
ACTGGAGACACTGCAGTTGGCACACAATGGCATGCGGCACGAGCGTGCCGATCTGGTAGAGAAAGAGCTCTTCGAGTCGCACTTGCGTGCCGCGCTCGTC
GGGGTCCGTCTCGATGGGAATGCGCTTGTCGTCCGGAATGATTTTCGCGTGGCACTCACGAGCTTCTTCTTCCAGATCCGGAACTTTTTCTCTTGCTTTC
AGTGGGGACGTGACTGACGAAGCAGTGTGCTTTGGAGAGGGAGGTGGGAGTGGTGCTACTGGACGAGCAGTGATCGGGATCGGCTGGCCGCTCTGGATGA
GCTGGCTCACGAGTTTGAACCGGTCGATGCAGTCGTTCAGTGTCTTGTCTTCTACGTCACTGGCGATTGCGAGCCATCGCTCTTTCTTCTCCATGGTCGT
CGGGTACTTTTTCAACGCCTCGTCCAGCGCTCGCTGCTGGTCCGCCGTCCAGTCTTCAGGACGAGCCAAAGGAGCTGCTGGTGTGGCTGGTAGTGGGTCT
TGCTGGGAACGTGATACCAACGTATCTGAAGGAGCTGGTGATCTACCGATCACGGCGACCGTGATTCCATTCGCCTTTGTTGGTGCCGCTTCTTTCCTCA
GGGACTTTTCAGTATGGGAAAACTTGCACTGGTCGCCCTCTCGACACGTCCCTTTGCCATAGAACTTGCACGGCGCCGGCTTCTTAGCCTTGCGCTTCTT
CTTCTTCTTGTCCATGCCATTCGCCTCGGGAGCTTCTGGCGCCGCCGTCTTTGACTCGTCCGGCGCCGTTACTTCAGATCGATCGTCGACGGGGCTAGCG
GCACGCTGAGTCGCGTCCTTTGTCTCGCTGGTGTCGGTCTGTTTCTGCTCTTTCTTTGCCTTTTTCTTACGCAGTTCCTTTGCCTTTTCATGGGAAAATT
TGCACTTGTCGCCGCTCTTGCAAATACCACGCAGCATGAAGCGGCACGGCTTCCGTGCTCGCGGATCCGATTGCTCGACAGCGTCTTCTTCGACGGTCTC
GGAGGCCACCGCCTTCTCCTCTACCTGTGACTGTTCAGCGGGCGGTGCTGACTCTTGTAGTAATCGCAGGATGTTGTTGTCGAGCCACGTGAGCAGCTTG
CGGATGCCAAGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGGCGCGGACGGATACGGCCTCCATGACGGCCGTGAGTTGTGTCTCGGT
CATGCGATGCTCCCAACTGCGAAGATCCAGTCGCACTGGCTCATCGGGGTATTTCGCTGGGAAGGTTATGAGGATCTCCGACTCGCCCTTGAATGCTGGC
GCGAGGTCAGGGTCCGAGAGCGACATGAAGCACCGCACGCAAACGTCTGAAGAGTTGTCGTCCGTGGCGACCACCGTGCCATGGTACCGACGCTGCACAC
AGAGCAGTTCCTTCACGAGAGCGTCATCGGCCTGCTGCAGTAGCGTCTGCCACGCGTCGTTGCTGGTCGTGGGCGTCGCGCTGGCGTCCGTCATGTGTCC
TTCCGAGAGAGAGAGAGAGAGCGCGCGCGAGTGAGAGAAGTGGGTGGTGTAGCCAAGCAAGTTTGCAAATGATCGAATAAGGCGAAGAGCTCAATTTGGA
TTTGGTGCTAAATCAGTAGACACCCATTTCTGCGAACATTCCGTTCGGTCCGAAAGGAACGTTCGGTGAACCCATATCGTACTTAGTACGAGCATCTACA
GTAAACTATACTAATCAATACATGTGGAGGCTAATTTGAACTTAAACTAAGCTAATTCATGTGGCGGTTTATGATGGGATCAGTTGGGCACCAAAGGCGT
CTTGGTGGGTTGATTGATTCCAGATGTGGACGCTACGGCTGCGCGGGCCCAAGGGCAAGGCCGCGACCGTGCAGATCCGTCCAGAGGCGCCACTGCGCGA
GCTCTGTGGTGCGTGCCTCTCTCATGCGCAACTGTGAAGCTCTCCATTGTTTGTGTCCACCGACGGGTTCGTGGAGCTGCTCGCAGATCTCGCGGCAGCG
CAGTTGGCGATCATGGGTGGCAAGCAGCTCCATCTCACGTGTGCGCAACGCACAGTGTTCTATACATCGCGTTGGTGCGGAACTCTAACTTGTTGGTGGT
TGCTCTGCTGGTTCTTGCGCAGTCCGCTCGGGCTTCCCGCCGCGCGTGGTCGAGTACACTCCCGACGACACAGTGCAGCTCAAGTTCGCGAACAATGACA
GCATCGTCGTGGACACTGCGTCACCGGACGCCGAGCCGCGGCAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAAGGGCCGCGCTGCGACACGTGGCGTCGCTGCCTCGGTCGCCAGGGCTACGGCGAATGCCCGTGCGGCGGCCAAAGCGAAACCCACGCCG
AAAGAACCCGTGCGCGGCGGTGTCCACACACTCCACAGTGGCGGCGCCAAGCCGAGAGCGGTCCCCGCCAGCCAGAAGCGCAAAGAGCGAGGCGACGGTG
TGCGACTGGGCGCGTCCATGGACGAGGAAAGTGTAATCGTGGATCCGGCTCCGCGCATGGACGATGGCGACGAGTCGGCGCCTAAGTATCGACGCACACG
CGCGCTGCACCTCACGTCGAAAGACGACATTGGCATTCAGCTCGCCGAGGCCGTGAGTGGCCAGTCAAAAGGCCGCGTGGGCCAGTTTTTCCGGGCGGCG
ACCAAGTCGGCTGTGGAGCACCGGTACGCGATGACGCTGGCGAACGCGAGGCTCAAGGCGGCGCTGTCCCAGCAGTTTGAGATCCAATCGATCGCTGCTG
CGACCAAAGACGGAAGTGAAGCGAGTGGCGGCGAGTTGCGGGTCAAGTTTAAAGAGAGCGTGCGCAAGTGGAAGGAAGAGACCGTGACGCTGCTGCAGCC
GATGGAACTACAGGCCGCGCTCAAGTACATTTTGATTTCCGGTGGCGACACGGGCCGCGAGATGCTCAAGCCGTTCAATATGGCCCAGGTCTCCCCTCGG
TACGTGTATGCTAGATTGCGGGCTTGTGTTTGGGAGGCATGGCACTGATGGATGGATTGGTCAAAGGGTGTTTTGGAACATCGCGCGTCTCTATAATGGC
GATGTCGAGGCCGGCCTGGCGGCGTTGGTGCCCGATGAAGACTGGTCGTACTTGGACACGCGGTCGCGGCAAATGTCCAAGAAGGCCATGGAGGCCAAGG
TAAAATCACACGGCCCGATGCGCTCGGACACCATCGAGGGGAGTCGTACTCACTGAAAACTGTGATAGGCAAATGAAGAAGTGTACAAGCAGTGGAAGAA
GAAGGGCACGACGGCCGTGGAGCAGGACGTGGACGTCGCCTCTCGTCGTGGAACAGCGAACGCAGAGCATGATGTGATTGAGATTGATTCGGACGGGGTC
AACGAGGAGAAGGACGCCGCGACGAGTGAGCAGCAGCTGCAGCTCGCGATGGCGTATGCCGAGCAGGCCGAGAAGAGATCGCTGCGAGAGGCCATGGCAC
GTGCGGCCGCGGCGCGTGTCGAAGCCCGAGCGCGCGCGCAAGAAGTGAGTGTGGCGATCCGGGAGCAAAATACGAAGGCACCCGTTGCGTCTCACGCACC
ACGAGATCCAAATGAGACCGAGTCGGAGGGTGAAGAAGAAGAAGAGGACGATGTGGAGAAGACCACGACAGTCTACTGCGATGCGTGCAACAAGGCACGG
ATCTTGACACTCGCCGAAGCGGCAGCCGCTGGCGTGAATGAGGACACCGCCGAGTGGACGTGTGCACGGCTCGCGGCCGTGGACTCACGCGTCTCCTCGT
GCGACGCGATCGACGATGAAGTCGAGCAGATTGCCGGTGCGACGCTCGCTCGCCTGCTGCAAAAGGTGGCGATCCATACGCGCTCCGACCTTGCGAACTC
GTCGATCACGGCAGCACTGCGCGGGTTGGCCCACCCACTCGATCCTAACTATGCTGAGACCAAAGCCAAGCTCCAGGAGCTCATGGACGAAGCGAGACTC
GACGAAGTCAACGACGCCATGGACGAGATTGTTGGCAGTAGCGATCTCGTGGGGGCGCTGGAACTGCAAAAGCTGGGCACGCCGGCGGATCTGGCCGAGA
CGCCCGCGGATCTCGTGGTCACAGCCATGGTTGCGTCCAGCAAGAAGACGCACAACGTGGATATGGAGCTGGTGCTGCAGTGGCAGGAGCATGCGCGCGA
GAAGATCACCAAGTCGCCATGGATGGGCGAGTGGCGAACGATCTAAGCGATTTGAAAGTTTGTGTAAATGGATTTCTTCTGTTGGTTTTTTTTTCTGTTG
TGACGGCCCCCACTCGAGGTACCATCGGAGGAGCTATGAGTGTGGCAGCAGCGACCCACCTTCTCTTCCCAGTTCGAAAAAGCTGGGCAGACCTGCTACG
CGTGAGAAACAACTTGGCTTTCTATACACTGGTGTCTTGTTCTTGTTCCTTCCACACTAGTGTCCCCACACGAATAGAAAAAAGCGGCCTTCGGTTCGGC
ATGAGCTTCTGGTTCGTGGGGGGACGCCTCTTGGATAAACGCGGATCGCTTGTGTCTAATCGATCTTGATCGAGGCGTAAATCTTGCGCGTGAACCACAG
GCACGCAAAGTAGCCAATGGTGCCCGTGAGGAAGAAGAACGTGAGCGAGATCATGGCCATGTAGCCAAAGTAGAGCAACCCCGAGACAAACGCCGTGATG
TTGAGCTTGGTGAAGAAGTACAGGAACGAGTAGAGGAACAGGTACACCGCCGCCGAGCCCGACGTGAGGAACGAACGCCACCACCAGCGGTAGTCCTCGG
CGCAAAGCTGAAAGTAGCACATGACGATCGTCACTTCGGCACACGTCGCGACCAAGATGATGAGCACGATGAAGAGGAAGCCAAACACGTAGTAGATCTG
GTGGAGCCACAGCGCCGACATGATGAAAAAGAGCTCAATGAAGACGGCACCAAACGGCAAGATACCGCCCACGAGAATGCTGAACAGCGACGACAGGTAC
CAGACCTGCTCGGGCACTTGGCGCGCAATCTGGTTCGTGCGCACGGGGTGTTCAATCTGCGGTGCCTTGAAGCCAAAGTAGCTACCGAGAAACACGAGCG
GTACCGAGATACCGAACCACAGCACGAGCAGCGCAAAGAGCGTACCAAACGGCACGGCCTGCGACGACGCCTTGCTCCACAAGACGAGGTTCAAAATGAA
GAAGACGCCAAAGAGACCGCCCGGGTAGAGCACCGCCGTGAGCACCGTGTTGTACTTCCAGTTCTTGCCGTTGAACATCTTGTACGTGCGCGACGAGTAG
TACCCGGCAAAGCTGCCCATAAAGACGAAGAGCAGCAGCAGCGTTGTGAGCAGCGAGCCACGGTTCGCGGGCGAGAGCAGGCCGAGCAGTGCAATGACCA
TGGTGATCGCACTCATCGAGCAAACTTGCACACCCGTGCCGACAAACACAGAGAAGAGCAGCGGCGAAAACTGCGGCGGGCGGAACACATCGCCGTGGAC
AAGCTTCCAACCGCTCTCTTCCTGGGCCTCTTCGGTCGTCTGGACTTCGTTGTAACGAGCAATATCGCGGTGGAGCGTGCGCAGCATGATCATGGCGATC
ATGCCCGTGAGGAAGAGTACAATCATGAGCGAGTTGATGATCGAGAACCAGTGGATCTTGTCATTCGACGACTTGGAGCTGATAATGCGGTCCCATCGCT
CCTCCCACAAAATGTCCGACGGTTGGAACTGCACATCGTACGTAAACAGCACCGTCGTGTCCTTGGCGGGGTCGAGGTACTGGTGGTTGTTCACCGCAAC
TTCTTCAATGTTGACAAACTTGCCACACGTCTTGGTCTCGAGCTCCTGGCCGGCGAGCGGCTCATTCTCATAGTCGTGCTTGATGGACGTTGGCACGACC
TCGAAACCGACCACGCGGAACTTGGTCTTGCCTTCCTCGGCGGCGTACGGGTCCTTGTTCGTGAGAATGATAATGCGAATGTGGTTGTACAGAAAGAACC
GCCCCTGCGCATCCGTCTCACCCACGGGGAAGCCGCGCTTGTACGAGCCGAGCTGCTGGTCGGCCGGGTCGCGGTAGAGCACGGGCAAGTTGTCGACGAC
CCACTGGACATAGTACTCGTCCTTGATCATGTCGATAAACTTTTCCGAGTCCTTGGGCTTGTACGTCATGGGCTTGCACAGCACTTGGCACCGCGAGTTC
TTTTGCATCTGCAGCACATAGAGCGAGTCCATGATCGAGTCGCCCGACATGATCTCGCCGAGGTTCTCGCTTTCTTCCTGGATCGACGCGGGCCGGCAAA
ACGGCAGGTAGTAATACTCGTACGGCACGAGCGTCTTGGTCGACGTGATCTTGTTCACATTGAGCGCGAGGTTCTCGCCGTCGGCCCAGGACTCGGGCGC
CACACCAGGGACATAGAAAGCCGCCTGTGCTGTTGGCACGATCGCCGCGATCGCCCCAGCCGCCGCCGTCAAGAGCAGCGAGCGCGTCCCCACCATGAGC
CCGAAGATGCTGCCACGTCGCCGATAGGGAAAGTGAGGGGGGAAGAGGAGAGAGCAAGTGCGGAAAAAAAACCAAGGGGAGGGAGCCAGCCCTCCGATAC
CACATATCATCATTTGGTTAACCTTTGATAAGAAATACATAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCTCCACCTGTCAAAG
GTGATTGAACACTACAGAGTGATGTTTTTCACCTGTGAAAGCTGGTACCAGATCGAGTTGAAGGGGGAAGTGGTAGTTTTCATTTTCATTGGAAAGATAA
CGGTCAACGGAAACCAAGCGGATCAGAACGACAAAGGGAAGCGGCGCCGAAGCCCCGCGGCGTGCCGATCATCCTCTCGCCTCCGTCGCCAGCATCGCCC
CTCGTGCCACGCCTATAGAGCGTACACGTGGTAGTGTCTCTGTTAGCTTGTCTGGGGATTCAAGGCAGCGCGCGGCTTGTTCGCTGGAAGGCGCAAGGCA
TCTATATCTGTCGCGCGTCTCGGAAACTACCAGCACCACCAATAACGGCGTGATCTCCCATTACGTTCAACGCAGCAACAACAGGCAATAACAACATGCA
AGTGAGCGTCGTGGCCGAGGCGCTCCATCAGCTCTATAGTCCGCAGAGCACGCCGCGCGTGCGGCGCCGCGCCGATTCATTGCTGCAGCAATTCCAGAAA
TCCCCCGAGGCAACGGTGACAGCACTGCAGGTCTTGCAGGCGCCCATTGCGACGGAAGAAACCGATGCAACGGTGCTCGCGCTGCGCAAAGCCGAGCGCA
TGTTTGCGGCGTCGACGCTCTACTTTACGGTCGCGACGTACGCGCGCAAGTACAAGCTCGAGGACGCTGTGAATTGGACCGACGCGGAACGCCAGCAGCA
CGAGCTCGTGACCAAGGAGTTTAGTGCGCTGTGCCAGCAAGTGTGGGATCTACTCACGGGTCCTAACGCTGCACTGGAAGAGCAAAACGTGCAGACGAAT
CTCGCGCTCACAGTTGCCGTGATTCTGCTCCGATTTCACGAGCAGCACAGCGAAGCGACCTTTGTGTCGGCCGTCGAGTGGCTCGTGACCAACCAGCGGC
GCCCCATGGTCGAAGGGCTCGCGTGCAATGTGACCAACTTTGCGATCCTGCTCACGCTGAAATTGGTGCCCGAAGAGGTCGACAACAAGCGCGTCAAGTT
TAGCAAGAACAAGCGCACGCAGTGTGAGCTGCTGGTCCAGCAGGCGGCGCCGCATGTCGTTCAGAACGTTCTCCCGAAAATCGCTGACGCAATCGACGCC
AACGAAAGTCAGACGCGGCTGAGAGGCCTGCTCTTGCAGTGTGTCGCGAGTTGGGTCGAGTATGGCAACGTGCCGGCGAGTCTGCTACTGGAGAGTGGGC
TGCTGAGTCGAGCGTTCCGGGAAACAACGACCCCGATGTTTACAGACGATGCATTTGAAGTCGTGCGGGAAGTCGTGCGTGCCTGCCGAAGCGACACGCA
AGTGCCATTGATGGTTTTTGTGATGACCGAGTTCGTGACGCTCGGGAACCATATCCGGCAACGGCTTGGCACAGACGGCGGGGCCCAGGAAGTTGCGTTT
TTGCTCAAGAGTTGTGCAGTCGCGATCAGCGAGTGTGGCCAGGCTTTTATCACGCATTTTGTCGAGTATACGGTGGACGGCTCCAGTGCGGCGCTCGTAT
TCGAGTTTCTCGAGACAGTGCTGTTCTTTACGAGCCTCCAGGACATTGCAATCTCGAACGAGACCATGGACTTTTGGATCGATTTCAGGCAGTATATTTC
GGGCAAGCACGAGCACCGCATCGGTGCGTTCGAAGTCTTTATTTCGCGCTTGCTGAATATCCTTGTCGAGCGCACGCAGATTCCGGTTGCGTTCGAATCC
ATGTCGCCGGTCGTCAAGGAACAGTTTGGCTTGTATCGAAACGACGTGCGCGCCGTGTTTCGCTCGCTCGCGACAGTCAGCGCCGCCAGCGAAGATCGAT
TTATTGTGGATGCGATCCACGCCATTTTCCACCAGTACGAACGCTTTGACGCTGGGGAAGTCGAGGAAACGGTACGGACAATCATTTGGCTTTGTGACCG
TTGGACCATGAGGACTGATGAGTGGTTTTTGTGGTGGTATTGCAGTGGTGGCAGAAGACCGAGGTATACGTACACGCTCTTAGTGCACTCTCCAAGTCCC
TTCGAGAAGATGATTTGTCTCTTGTGCCTCGTTTGTTCGACTATTTATCTCGTGACGAGCCATCGCACCTAGCGCTGCAACGCACGGCCACGATTTTTCT
GGGCGTGGCCAGCCACTGGTTTGCGAGAAACCCGTCGTTTATCGATCCTTTCGCGTTCAAAATTCTTTCCAAGAGCCTCAACCTGAGCCAGCCTCACGCG
CAGTTCCCGTTCCGGGCGCGTGGGCAAGAAGACCACGTTGGGACGGTTGCGCTGCGCAAGCTCGCGACGAAATGCGGCATCCATCTGTTCAATCCACTAT
GGATGGAATCGATTGTACAGCTGTACCGAGGAAGGCTTTTGGCCTCACGGCAAAAGGCGGCTGAGCTGGACAACAGCGTCACGCTCGTTGTGGAGTCTGT
CGCGCTCATTGTGGCCAGGGTGCCGTACAAAGACGCGCTGCCCGTCGTGGAGGAGCTGTGTTCGATCATGTTGGAAGAGCTCGTGACCCAGTATGGGACC
CTCAATCCAGAAGACGATAATTCGGTCGAGTTTCTCTCTGCCATCCTCGACCATCTCCATGTACTCGCGACACAGATTCCGCCGCAGATTGACCAAGAGA
TTCCGCACCCAGTGCTCACCGTGCTGCAAAAGCACTGGCCACTGATGGAGGGCATTCTGCGTGCGTACGGTGCGAACGAAGACGTGATGGAGAAATTCTG
CGGCGTGCTCGTGGGGCTCTTCGAGACCATTCGATTCCAGGCGCTGGATTTAGCAGGCGCGATCATGTCGCATTTGCTCGCGCAGTTCGAGCGGACGTTT
GATGGCAACTTTCTAAAGGTGATCAAGGGCGTGATCGCATGTGCCGGCGACGACGAGGAGACCATGGTGAGCTTGACGCGCGTGTTTGTGATCGTCGTCG
ACTCAGCGCTCAGCAAGATTGCTGCCGGTGGGAGTGTGGACGAAAACCCGGCACTGGTCGTGGCAGTTTTTGACTTGGTCCGATCTTGCGGCTCGAGCCG
TCCGAACATTCTGGTCCGCTCACACAAATTCGAGGCGCTGCTGTCGCTCATTCTCCATGCGCTAAAGGCGCAGAACCCCGAGATCTGTGCTGCGACGCTG
GACTTGCTCAAGGTGATTGGCTCATGGTACGGTGAGATCCAGCGTACGCCCGTGGAGCTACTAAAGACGGGCGAGCTAGACGACAAGGTGAATCTGCACC
ACCTGATCCGCTCGCTGTTTTTCGAAAAGGACCTGCAGTTCCATCTCTTGGTGGCACTTTTCCAGGCCGCCGGCGGGTGCATGCCGCCTTCGCAGATTGA
CAATATCGCCGAAGTCGTGCGGTCGTGCTGGACGTACTTTGGCCGCCAGCGCAGTGAAGAGCTGCTTCTGCGGCTGCTCGCCGACGATGGCTTCGTGGGC
ACCCACGTGCCGCCGCGCATGCGAGGCGAGTTTGCGAATGCGATTGTGCGGCAAGAGTGCATCGACAACTCGCGCAAGTTTCGCCGCGTCTTGAGCGCGT
TTTGTGACCACTTTCGCAAATCGGTCAATGGCGTGACACCGCCTGGCATCACGTCGTGACGGACCCACCCGAAGCAGTGGCATGTAACGGAGCCGTATCC
ATGATGAGGATCATAACGTTGGAATTTAGGGAGACCAAAGTGGGAGACAAGGATAAAGACAATTACCGAACTGTATCGCATTCCAGATGACGGAACCCGT
CCATGGGGATGACGAGTTACAGTGGCAGCTCTGCGTACGTAGTCGTGTTCTGGGTTAGAGGAAGGGATTGCCCTCGTCCTTCCACGTGCTCGCGTTGTTC
TGCGTTCGCACCGAGATCAGGTGGCCGCTTGCGGGGCGCGCACTCGGCGCCGTCTGCGACCACTCGATGATCTTGTCGGCGACTTCCTCGGGCGTCGTCC
AGGTGGAAAAGTCGGCGTCGCCCATGTATTTGCGGTTCATCGGCGTGTCGATGGTCACGGGCAGCACTCCGAGCACGGTCGCATCCTTCGGAAGAGAGTC
ACTGTGCCATGAGGAGAGTGAGGAAAAGGAAGAGCAGGGTAGCCATGGTAGGAAGCAAACGTACACGGAGCTGGCAATCAGGTGGTGGGTCGCGGCCTTG
GACATGCCGTACGAGACCATGCCAGGAGTCGCTACAGAGTCAAGTGGTGAGACTGGGATACAAGGACAGATACGGAAATCTCACCAAACGATGCATCTAC
CTTGCAGAGCGGCAGCGGCACCAGTGAGCACCAGGAGACCACCGGGCGACAGCGCGTGGCTCGCCACGTGGGCAGCTTCACATAGAAAAGTAAGATATCT
ATAACCAATACGGTGGGAATGGATACGAATAAAACGAACCGAGCAAAGCCGATTCGGCGTTCTTGGTGTGCATTTCCGCAAGATTCTCGAGCGAGTCGGC
GTCCTTGATGGAGCCACCTGATCCGAACAGCAAAGACCGAGATATATCAGACACAGGTGAGACCAGTTAGCACCGGAGTCAATCATACGCACCAGCCCAG
CCACCGGCCGTGCAAACCACTGCATCCACCTGGCCAAACCTA