Description :
From Genome Similarity Track
Location :
Scaffold_55:90610- 95232
Transcript NameFunction/comments
Aphas_H257_14707Hypothetical protein

Sequence
4622 bases(100 bases per row)
AAGTCGATCAAGCTGGATGTGGCCAAATTCGGCGGAGCGGAGACGGAAAAACTCCTCCGCTGGCTTCTACAAGTCAGCACTGCTGCTGACTCTCAGCGTA
TCTCCGACGACGCCACCCGTGTAGCTTTCGCGATGTCGCATTTGAAGGGTCGTGCGGAAGATTGGGCGTTCTCCAAACGCTTGACGGACCGCCACTGCTT
CCCATCTTTCGCGGTCTTTGAGACCGAACTCAAGGCAATGTTCCTGTCACCCAACAGCGACTTTCGCTATCGCTCGCAATATCTGGCTTGCAAGCAAGGG
AAACGCTCCCTTCAAGAATTCATCCATGATCTGCGCTTCCTGGCTGCGAACATTAACGATGAAGAGTCACTCCCAGAGGCCCTACAGGTGACCGTTTTCA
TGGACGGTCTCAACCAAGGCCCGGCACGCACACAGTTGTTTCGCGCCTACCCGGACACCTTTGAAGAAGCCGTCCGAATCGCGCTTTCGGAATCATTCTC
TTCCTCCTTGGCGCACACACGCGCGGCGTCCTCAGACATGGATGTCTCCATGCTCGCCCAGGCATCGGACGACCGCACCTGTTTCAATTGCGGTCACCCA
GGACACTTCTCCCGCGCATGCCCGGCCCCTCGCCGTGTAGCGTCAGCCGCCCCACCCTCGCACGGTTCCTCCCGTACCGCGCCCGATATCCCTTCGCGTC
GCCCTCCGAGCGGTCCACGTAACCGCTTCAATCGTGAACGCCATGGTGGCTCACGCCCACCATTCCGCCCCGCTCCGAGCTCGAGTGCGGCGGGAAACGG
TCGCTCCCAGTAGGCGCGAGGCGACCTACTGGGGACACCCTAGGTCCGTTGGAGGTGTGTGGCGCGCTGACACACTCTAAGGACCTAGCCTCGGACACAG
ACCTTCTTCTGTGTCGTGTTGGGCTCCAACCCAACAAAATGATTTGTTTGGAACTTTCGTGCCTGGCTTCCCGCCAAGGCTATCTGCTTTAATCGATTGT
GGGGCGTCGAACATCTAGCCGCTCCACTCTCTCTCGCTTCAACCGCTTACCCCTCTTCGGATCCCTCCGACAGGGTTCGCGTCAAGATGGCCGACGGCCA
CACTGTGTCTCAACCACGCATAATCGTCGACGTTCCCATCACCTTCGACGGTTTCGACTCGACCGAACCGTTCTATGTTATCGACCTCGATGAGAGATGG
GATCTGATCATCGGGATGTCCTGGCTGGAGTCCCACCAGCCATGGATTGACTGGAAGGCCAAATCCGTGCACAAGGATACTTAGCTCAACGCGAGCCAAC
CCTGGATTCATCGGCAGGCTGCCGATCGCCTTCCCCCATCCACCACCAACCCGCTTGGCTCTCCGCTAGAGGCGATGAGTAATGATCTCGCCTCTCCTAG
CCCCGCAGCGCGCTCATTGGTCCCAGCGCCCGCGGCCCCAACGGACCCAACCACGGTTTTGCACAATACCCCTTTCGTGCCCCCAACAGAGTCACCCTCT
GAGTTGATTCTGCAGGCCCTTTGGTCATTCCAGTTTCTTCTCTAAACTGAGCCCTCACTGCTGCCCAACCGCTGCTACTCAACACACGTTCGTGAAATGG
TGCGAAGGACTAGTTAGGTGGGCATCTACAACTACTGTACATGCTACTAAGCTCAAGCTACGGTGAGGCTCCGTTACCGCCCCCGATAGTGGCCTCGACC
TTGGCAACCATGTTTATCCAAGAAACGTGTAACTTGCACGAACTCCCTCGGACGTCTTCCGAGATCCTGGAACTGCCAGAGATGAGCTTCCACTCACTCG
TGGAATCCCTCTCTGCGCCCACGATATCGCCGCCTTGGCGATCATCACAGTCGAAGAAGAGATGGATCTCTTTTCGACCTTGGCCGCAAATGACTCGGTC
CTCCGGCTCCATCGAAGTCCAGACGTGGGACTCCCTACGATCCAACCCCTATTTCGACCTCCTCCAAGAATTTGAGGACGTCTTCCCCGACGAGGTACCG
TGTCGCCTCCCGGTCGACAAAGGCGTTCAACACGAGATTGACCTCGTGCCCGGCGCAAAGTACTGTGTAACGCGGCAATGGCCGCTTCCTCGCGACCAAG
TCGATGCCATCGACGCTTTCTTCGCGGCCCGCAAGGCGGCGGGTCACGTCCGCGAGAGCATCTCCCCTCACAGCAGCCCGACCTTCTGTGTGAAGAAGCC
CGGTGGGAAATGGCGTATTGTGAACGCAGCCACGATTCCGGCTCAGACGCCGATTCCTCGCAAGGACGATATTATCGACATCGATCCACCATTTTCTCCA
CCATCGACCTTCGCGATGGCTTTTACCAGATCTTGATGGGTCTATGCAACGTTCCAAAAACGGCGGTCTCTAGGCCGAGCGGCATGTTATGGGAGTGGCT
GGTCATGCCACAGGGTCTATCCAACGCCCCGGCGACGTTCAATCGTATGGTTACCGCGAAGTTCCGCGCGTTTCGCGACTTCGCTCCGTCGTACTTCGAC
GACATTTATGTTCACAGTTGCGCATCCTCCACGCAATCCGATCTTGACGTTCACCGCGGCCACCTCCACAAAGTGCTTGAAGTCCTCCGTGCCAACGGAC
TCTATGCCAACCTCGCCAAATGTATGTTTGGCGTTGACGAAATCCCAGTCCTGGGCGATTTCGTGGGGGTGAACGGATGTCGGGCTGATCCTGACAAGAT
CAAGGCCATTGCGGAGTGGCCTATCCCCTCCTCCGTCAAGGATCTTCGTCGCTGGCTGGGCCTTGCGACGTACCTGCACAAATACTCGCAAAACTTTGCG
GACATCGCCCAGCCGTTGTTTCGGCTTCTCCTCAAGGACGCCCCTTGGGTTTGGGACTCCGCTTGTCAAGAGGCTTTCGACGGCCTCAAAACCAACCTTC
AACGCGCCCCGATCTTGGCGCTCCCAGACTTTGACAAACCTTCCTTTCTCCGTCGTTTGTGACGCTTCGCAATTCGCCATTGGCTGCTGCCTGATGCAGC
TCGACGCCTCCGGTCACCCTCACCCGGTCTCCTACCAAAGCCGCCAACTTCACGCGGCTGAGCGGGCGTACCCAGTCCACGATTTGGAACTTCTCTCCAT
GAAGTACACCCTGACCAAGTTCCGCATCTACCTCCTCGGCGGAAAACCCTTCGTGATCTACACCGATCATACGTCGCTACGTACAGCGACGAATACACCC
CACCTTTCACAGCGCATGGCGCGCTGGATTTCGTTCTTCTCCAAATTCACATTTTCGGTACAGTACAAGCCCGGGAAGGACAACATCCTGGCCGACGCCC
TCTCTCGGCGCCCTGATCTCGAACTGACCACGATCGGTCTTTTAACGACGGGTCTTCACGATAGAATTCGTGAAGCGTACCCCTTTGACGCTGACTGCTC
GTCGCGTCTGGCGGCGCTCACCGACCCCGTTTCCCCCAAACCCCGCCGTGCTTCGTCGGCCTTACACCGCTTCGCCCTCGCCGATGGGCGTTTGATATTT
TCAACCCACCGCGGACTCGCCGCCGCGCATTGTTGTGCCCGGTGACGCGCAACTGCGCCTCACTCTCATTCGATCCTACCACGACTCCCCTAGCGGCGGC
CATTTCGGCCGCGACAAAATGCACGCGGTTCTAGCGCGCTCATACTGGTGGCTCCGCTTGTATAAATCCGTTGTGCGCTATGTCGCTCATTGCGACGCTT
GCCAGCGCACTAAGATCACCGCCTCCTCTCGGGCTCCGCTACAACCTCTGCCTATTCCGGACGAACTTTGGTCGTCCGTCAGCATGGATTTCATGTTTGG
CCTGCCGCGCGACGCCGGCATTTTGGTTTGTGTCGACCGAGCGTCGAAGTATGTTATTGCCGTCCCCGTCCGGGGCACGATGAGCGGCGGAGATACCGCT
CGCCTCTTTTTCGATCACGTTTTCTGTAGTTTCGGCCTGCCTCGCTCCATCGTTTCAGACCGCGACCCGCGGTTCACGGCGAAGTTTTGGTCCACCTTAT
TCGCTCTATGCGATACCTCGCTCGATATGTCGACTTCGGATCACTCCGAGTCCGATGGCCAAACGGAACGTGCCAACCGCGTCCTCGAAGATATCCTCCA
GAGCTACTCTGTTTCTACCGGTTCCTCGTGGGCTGTCACGCTACAGCACGCGGTTTTTGCTTACAACGTCGGTTCAGACGTCCACTGGCTTTTCGCCGCA
TTATGCGGTCCATCTCCAACACCCCCGCCTCCCCCCTATGCTCGAAGGTTCGATCTCCAGTGGGGGTGGAGTCACTTCGCGGCTTCGTTCCGCGGGCATA
CTTTCCAACGCCCCCAGCCGCACTGTCGAAACCATTCAGAGTTTCCTCTCCCGTCGCGTCTCTGTTATGCAACAGATCCATGACAGTATCGCTGCCGCTC
AGCAGCACCAATCAACTCAAGCCAACAAACATGGCCGTTCTAACTTCGCGTCTTTCGCCGTGGGCGACGTGCGGTTGGAATGTCTTCCAACGTCAAGCTA
CGCAGTGCTTGGCACGGCCCCTTTACCGTTCTTCGCGTGGTCAGCACAACCAACTAGAAGCTCGATAGGCCCAACTCATGGCAGATCCATCCAACATTTT
ATGTGGGTAAACTCAAACGTTA