Description :
From Genome Similarity Track
Location :
Scaffold_11:9060- 12111
Transcript NameFunction/comments
Phymu_g830hypothetical protein PHYSODRAFT_554371
Phymu_g831hypothetical protein PHYSODRAFT_475011

Sequence
3051 bases(100 bases per row)
TGCTGCCTCCGATCATCTTCGAAGGAGGCTTCTCTATCAAGCGCCAGGCGTTCTTTCGCAACTTCCCCGCCATCATGAGCACGGCTGTCGTTGGCACAGT
CGTCGCAGCGACGATTACAGGAGGCGTGCTGTACCTCGCTGGGCAGTCCAAGATGGTCACGAGACTTTCGTGGGTGGAGGCTTTACTGTTTGGGACGCTG
ATTAATGCTGTGGATCCGGTAGCGACGTTATCGTGCTTCAATAAGCTGCACGTTCCACCACTGCTGTTCAATCTGGTGTTTGGAGAGAGCGTGATCAATA
ATGCGGTGGCTATTGCGCTGTACCAGACACTGCACAAATGGGACGTCGGCACCGACTTGAGTCTGAAGCAATTGTTTCACGTGGCGATCAATACGAGCTG
GATGTTTGTGGGGTCACTGCTTGTGAGCGCAGTAATCACTCTCTGCGGCGCcttcctgctcaagcgcaaggtGTTTTCATCGCTGCACTTCTTCCCCAGC
TATGAGATTTGCTTGTGCTTGATTTTCAGTTTGCTGACGTACTACGTTGCCGACAGTTTCAAATTAAGCGGCATCGTAGCGCTGTTTTTCTCGGGAACGA
TGACAGCTCACTACCATTTCAACGTGTTATCCAGTGAAGCTCGGCATGCATTTACACATTTGTTGCACACGTTGTCGTTCGTGTGTGAAAATGTCGTATA
CGTGTTCATGGGGACTTCGGTGATCATGATCTTTTCGGGACATCCTGAAAAAAGTTTAGGTGCTGCTCTACGGGTAGACGACATCGACTGGCACTTCATT
GGCCTTACACTCGTCGCGTGTGTTgtcgcgcgcttcttcaaTATTTTCCCGCTGCTAAACCTTTCCAACTGGTCGCGGGAGTCCTCCGACCGAATTCCAT
TTAAGTATATGAGTGTCATGTGGTTCGTCGGTCTTCGGGGCTCTATCGCGTTTGCACTTGCGAAGAATTGGAATTACATCGGTCGCTACGGTTCTCACCG
TCAGCTAGTGGAATCCACCACTCTCGTCGTGGTACTCTTTACAACGATTGTTATCGGCGGTCTAACTGGACCACTTCTCTACAAGCTGCGTCTTACCAAC
CACCACAGCGCTTTGAGTCAATCTGATCCTGAGCCGAATCCAGAAAGAGAGTCGAGCGCTGGGGAAGATCAAGCACGGGTATTGCAACGCAGCACGCGTC
ACTTCATGCTTCGCCGGAACTCGCGAGCCACcgagcagcaagctgaaCAAAGAGCATCAGAAGGATCTACTACTGCACGAGAGCAGGAGGCTGGTCTAGA
GCGAGACCCAGTGTTTACATCGCGGCCACAGTTCCGAGATGAAGACTACAGTGAGAAtgatggaggagacgcaCCAACGCAGCGCCGCGAGACTCGGACC
GGCGCGTTTATCCGCAACTGGCAGGCTTTCGACACAGCGTACATGCAGCCTTTCTTCGGTGGCCATAGGTCCCCTGCGAACAGAAGGCcagttgaagagg
aagaggaagcaggTACACACAGACAGGATCTTgacaagatgcagatgcagagTGCGGTTTGATcggcaacttcaacttaccGGTTTTGTTTAGTGTAATC
CACACAATATGTTTGCATACTCAATCCAAGTCTTTCAGTTCAGCAAATCCTACGGTTTTGCTGACTAAAAATGACGTGTCGCATACTGCGATGGCCAATC
GAATGAAGCCAGACTCAACACACCCAAGTCAGCATAGCGAAGGAAGAGAGATCAGgacaagatggaggacgcagtgctgttgttgctcatGCTTTTCGTG
CTGGTGATGGCGTCCTACATGCTGGGGCGCTATTCGTGCATGTTAGTGTCACAGAGTAGCTTCGCGCTCATGTTTGGGCTCTTCGTGGGGCTCTTCATGA
TTATGGGCGGCAAGCACGCGGCGCTGCACACTCACCTGAACTTGGACAACAGCCTCTTCTTTAATGTATTGCTTCCTCCGATCATCTACGAAGGTGGCTT
CTCCATTAAGTGCACGGTATTCTTCAGGAACTTCCCGGCAATCATGAGTACGGCTGTGCTGGGAACGGTCATCGCCACGACCATTACAGGTGGAGTTCTG
TACCTCGCGGGGGTGGCTGGAATGGTGACCAAGCTTTCGTGGGTGGAAGCTTTCCTCTTCGGCACGCTAATCAGTGCTGTGGACACGGTGGCTACTCTGA
GTTGTTTCGATAAACTTAACGTACCGCCGTTGCTGTTCAATCTCGTATTCGGAGAGAGTGTGATGAACGACGCTGTGGCGATTGCTCTGTATCAGACGCT
GCACAAGTGGGAACCGGACAGTAACTTCAGTGGTAAGCAACTGCTGCGTGTGGCGGTCAATACTGGTGGCATGTTCGTGGGGTCCCTGATTATTAGCGGT
TTGATTACACTCGGCGGAGCATTCCTCTTAAAGCGCAAGTTCTTCGCAACGCTGCGTTACTACCCGAGTTACGAGATCTCGCTGTGTTTGATCTTCAGTT
TGTTGACGTATTTCGTGGCAGATAGTCTAAAGTTGAGTGGAATTGTggctctcttcttctcgggtACTATGACGGCTCACtatcacttcaacacgctGTC
GAGGGAGGCGCAGCATGCGTTCACGCACTTGTTGCACACATTGGCGTTCGTCTGTGAAAATATTGTGTATGTATTCATGGGCACATCGGTGGTTATGATT
TTCGCGGGTCATACTGAGGAgaatgctggagctgcgctaCGCGTGGATGATATCGATTGGTCTTTCATTGGCTTGACGCTTGTAGCCTGTATTGTTGCTC
GCTTCTGCAACATTTTCCCGCTGTTGAGCCTCTGCAACTGCTTGCGCTCCCCATCCAACCGAATTCCGGTTAACTTCATGAGTGTGATCTGGATGGCAGG
ACTTCGTGGATCTATGGCCTTCGCTCTTGCTAAGAATTGGAATTACGTTGGGCTTCATGGAGCGTCTCACCGGCGACTTATCGAGTCGACAACACTAGTG
GTGATTCTCATCACGACCATTGTGATTGGCGGTCTCATGGGTCCGTTGCTG