Description :
From Genome Similarity Track
Location :
Scaffold_40:90566- 92410
Sequence
1844 bases(100 bases per row)
AGAACACTCTCAACGCGAAGACGAAGACGCAGCGCTTCGACGAGCAGAGATGGGACTCACTGAATTCAAGTTCCTTCTATGATATTCTGCTGGAGCACAA
GTATGTGCTCCAGGAAGAGATTCCTGCGGAAGTTTCGCAGGACAATAGCATACAGCACGAGATTGACCTCGTACCGGGTGCGAAGTACTGTGTGACTTGG
CAGTGACCACTCCCGCATGATCAAATAAAAGCACTTCTTTGAAAGTCGTCGTAAAGCGGGTAAAGTGCATGAATCAAAGTCCCCGGCCAGCGCACAAACG
TTCTGTGGCGGATGGGGCATCGTACATGCTTACAACAAGCTGAACGATGCGACGATACCGGCGCAGAGGCCGATACCACTAAACGATGTCGTCATCGATT
CGATGGCCAAGAGCACCATCTATAGTGCTCTTGATCTGCGCGACGGGTTCTATCAGATCCTGATGCGTGAGAGGGACATTCCTCTCACGGCGGTGAGCAC
TCCGAGCGGTGTGCTTTGGGAATAGCTCGTAACGCCGCAGGGACTGAAGAACGCTCCTGCAACCTTCAAAAGATGTGTGACACATCAATTGCGCTCAGTG
CGTGACTTCGCACCGATCTACTTCGACGATGTGTTCGCTCACAGCCGGTCTGTGAGCGGGAAGACTGACGTTGAGGTGCACAAAGAGCACCTCCGCCAAC
TGCTAGGGCTTATGCGTAAACATAATCTCTATGAGAACCTGTAGAAATGTATCTTCGGGGCGAGCGAGATACCCGTCCTTGGGTGTCTCGTCGGGAAGAA
CGGCGTACGCCCTGACCCAGCAAAGGTCAGAGTGATAAATGAATGGCCTACGCCATCCAACGTGAAAGAACTGAGGCAGCCTCTCGGACTTGCAACGTAC
TTGTGCAAGTACGTTGAGAATTACGCGGGCTAGATTCACCCGCTGTCACAGCTCCTGGACAAGGAAGCTGAGTGGAATTGGACTGGTGAGTGTCAGCAAG
CTTTTGATACAGTCAAGCAAAGCTTGACTGAGGCGCCGATCTTGGCAGTAGTTGACCAAGATCGTTCATTCCACATCGTGTGTGACGCGTCCGATTTTGC
GGTCGAATGCGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTGGTCTACTACCAGTCGCGTCAGCTGAAGCTAGATGAGCGTAACTACCCTGTA
CATGACAAGGAGCTCCTTGCCATGAAGTATGCACTCGCGACGTTCCGAGTGTGAGTAGACCGTTCGTGATCTACACCGACCACGCTTCACTGTGAGCAGC
AGTAAAGACTCCGTATATCTTGCAACGAATGGCGAGAAGGTTATCGCTCTTTGCGGAGTACAACTTCCAGGTTGAGTACAAACCTGGAAGGCTGAATGTG
GTGGCCGACGCGTTGCCGCGTTGACTTGATTACACTGTTAGAACAGCCGATGTCAATCGAATTGGTGTCGGACGAGTAAGTGTTCCGTCGTCGGCATTGA
TCGCAGATGTGCAGAACGCGTGTGCAAGTGACGCAGACGCGAAACAACTCCTAGACTATGTATTAGCACCTTCCGACGCGGCACATCGGAAGTTGTCGCT
ACATCTGCGAGCTCGTGCACGAAGGACTGCTGCTTTACAGCGGAGTGGACAACGATGCGGATCGCATCGTCGTGCCGAATGATTATGATCTGCGTAAGCG
GGTCAAGTACGAGTATCGCGATGCCCCTATGGCAGGTCATCCGGGACGTGAGAAGACATACACTCTTCTCACGAGAGAACCACCAGTACAAGTGGGTGTG
AAAGTACGCACGTGCTTGCGAAGTGTGCCAACGCGTAAAGCCTG