Description :
From Genome Similarity Track
Location :
Scaffold_378:9056- 10442
Sequence
1386 bases(100 bases per row)
TCCGGCCCGATTCGAACCGGCTGCGTCACTCGACACTAATTTATTCACTGTCGCGGAACTGACCTCAACTTTCCCGTCGTCAACCTTTTTTTAATAATAT
ACGAAAGACGTATGATCCATAGATTGTGAGTTTGATAAAAAAAATGTCTCGCAACCAGCCCGTAAATCCCTTAGCCAAATGTCGACAGTCTATTGATCAT
CTACGGATAGATATACAGTTCTCAACGGCTTACTCCATATTCGTCTGTTGCCAGCGACACACCTCGTGTCGTTGTACCAGATCATGGTGATCTCCGATTA
CGTATCGTGTATGAGTACCACGACGCACCTGTTGGTGGACATCGTGGTCGTGAGAAAACATATCTCACAGTGAGCCGCGACTTTCACTGGCGTCGCCAGT
ATCAGTTCGTGCACAAAAACGTTCGGTCCTTCGAGGTCTGTCAACGGGTGAAATCTAGTCCTTCTCTTCGAGCCCCGTTGTAGCCTCTACACGTCCTGGC
AGAGTGATAGGAATCTGCTTCAGTGGACTTCGTCTTCGGATTTCCTGCTGACTCTCACAAGAATACTGGTATTCTTGTGTACATTGATAGATTCATCAAG
ATGATGCATCTGGTTGCTGTACCCGAATCCATAAAAAGCATTGGCTTGTGCCCGGGTGTTTATCGACACGTTCTTTCGCCTCCATGGGTTGCCTCGTGAA
CTCGTGTCCGATCAGGACCCGCGGGTCACAGCTGAGTTCTGGCGTTCCGTGGGAAACAAACTCGGAACGCGTTTAAAGATGTCCACATCAGGCCACTCTG
AGACCGATGATCAGATAGAACGCGCCAATCGCGTCCTCGAAGAGATCCTTCAAGGGTACGTCCATTCTTTTACGAATTGGAGCGAATTCTTGCCGATGGT
AGAATTCGCGATCAGCAACTCGGTCGACGCGTCTACGACGCACACGCCTTTCTTTGTGAATGGCATGCGTCATCCGCATCTACCCACCTTTTTAGACTGC
GGCTCTCGTTTAACGGGGGGGGAGCTCATTCAAGCAAACGCCAGTCTGGCTCTCACTCATCACGTGCTGACCATGAGGTCACCACGCTTGACGCCAATGT
CGATCACATCGACTTCGGTGGGGGAAAAAGAAAAGCAAGCGCGAGGATGATCTTATAACCAGGATCATGATCAAATCAACAGCACGCCCAGTGATTCCAA
ATACACACTCGTTGAGGCAGCAGCTGATTTTGCCGCAGTGCACTCCAAGAGCACTGTACTTTAAGATAGCGATTCAGCAGATGACTTCATACTGGCTCGC
GAAAGAGTTGTCCGTTTCGTACAAGACACTATTGTAGAGGTGGTGTATAAATAAAATTAAAACGCTGACAAGAATGGAATGCAAGT