Description :
From Genome Similarity Track
Location :
scaffold_20:90555- 94844
Sequence
4289 bases(100 bases per row)
CTCTTTGGTTAAAGCTTCCACTGTGCAAGTGACACGGCAATCCCATTGCACATACAGTAAAATCCTGCGACTTAATCTGTATTTCTTGCAAAATTGAAAC
GCGAGTTCTTCGATTAATTGTACTAGACACAATGGGACAGCCTTTAATAAGCTATGTGTTTACTTGACGGTGCAAGAGCCGGAAGCGGTGTTTGACCACC
AGGAGGTGCTCGCGAGCTACAGGATTGCGCTCGTGAGACATCTATCGAAAGGCCTCAACAAGATGTTGGTGGAAGCGCAACTGGCTTCCACGGTAAGGCT
ACTAATATCAAGCGTCAACCCTCCGGGGGTAGAGATGGGGAATTCTCTCCCAAATGGTAAAAGCTGATAAGACGATGAAGTCGCTCATGCTCCAGATGTA
GCAACAGCGTCAATAGCTTACGGTTTTCAAGCTAGGAGGTCACGCTAAAACAGGAGCTCCTTTGGTAAATCTGCGGAAGGGCATTCTTAACATGGAAAAG
TTCAAAGTGAGGAGTACGCGTCGTCTAAAACGGCGTATATGGTGCATTCCAGCTTCGTGTGCACCCGTCAAGATTGGCGATATCTCGCACACTACGTCCA
ACGGCTTCAGACTTCTATTTACGCAATGGCAGCAGGCCCTATTTCAAAGGCAGTAGTAGAATGCTTTTTCATGATAGGTCTCCAAACAGGTGGTATGCAT
ACCAAGATCTACAGCTTCCACCTGCACTCTTTTACGAAAACGGTAGGTGTTGCATTATATGCGGGTAAAAAATAACCTCTGTGTCGCAAAAGCAGCAAGG
TATAGCTGGAGCAAAAGCTCTACGAAGCGTCGGGGGCGACGCACAACATCCATAATAATGAGGAGAAGGTGTTCTCCTAGTTGCAGAGCAACTCCACAGT
AATTGCAGATGTATTACAAGTAGTATTGCAAAACACATGCACCTCGCGTGCTCCTTTGCTAGCAGCTGAAATGTACAGGGGTCGGGCAAGGTCGCTGACG
AAGCTCTTACAAAATAAAATTATCGTCTGTGGGTCTTGTTGGTAGTTTTGAAGATGCCGAATAGGATACAGTATCCGCGCGTCCTGTGAAAGTGATGATG
GCAAAAGTGATAAGGATTATGTTGAACTTTCAATTGAAGTTTGCGAGCTATGTCAGCGTAAAACACTGTCTCGTTTTAGCCCAAGATTTGGATTCGAGAT
ATATCGTCATCCAAGGACTGGTTGACTGAGGCGCCATGCACTCCTCTTTTAGTGCCTTGGTGTTTCATAAACACACCGCTGACAAAAGTCTGAACTGTTT
CAGGCGTGGCCACAATACTACAATAACTCATGCACTATTCAAATAGTCTTGCCATGATGTTGCCAAGTGCATGAAGTAGAATCCGACAGGAAGAAGCAAC
AGTGAGTTGTAGTTTTGGGATGAAATAGAGAGAAGCGGTTGCATATTGCGGTCTCCGTGCTACATCTATGTTTAACAAGAAGTGGTGCTTAGGGTGTATC
TGGTTTATGATTTTAAAAATAGCCAGAATTAAGCCTTCTGAGCCAGGGTCGGAAACGATTGGGTGTCGCAGCCTCTTGTATCAGAGCCAATGGAGCTGAA
GGGAAACTGTCAAGCGCAAGTGTAAGTGCCAGGAACCTGAAGCTCGGATGGGTTATCCATTCTTGTCACGATGAAACGGTAcggctgagtcagcactacc
gtgtGGTGTGCCAGCTGTGTGGAGCAATAAACTTGCAGCTAGAAAGATCGTTCACTTATGTTTGGAGCAGCCAAGTCAGCTTTGATTGTAAGTCTCGCCT
CACTGCCTCAGACTGCAGCTCTAATTGAGCTTTAAAAATTACGTATGCATGTTTACAAAGACTTGCAAGAAGTGAAGCCACCGAAATGGTTCAGTTGGTA
CAAAATGAAGAGCTGAGGATATAGCTCGTAATGCGTGAATGTGTCAATGAGAATATTTGAGCAGAGCACTGAGAAGTGAGGCAGCTATCCTTACTTTTTA
AATTCTCCTATCCATAGCTTCAGTTAAAATGACGTGATGAAGGGAAATCCACAACGAGTATCACCCTGTATCGGAATCTATGTCATGAATTTACCCGGTT
TATGGAACCAAGCTTTGCGTCAGAAAAATTGACCCTCAGCAACGAAACAAATCGACGTCGAGGAATGTTTTCTCCATGCAAAGCATAAAATAAAATTACT
CTTAATTTGCATCGGCAGTGTGTCAGAAAGGCTAACGGCAAGGGTGATTTGTGCACAGCGTCCGGTGCAGACGCAAGGTTTCTAGACAGATGTGCTCCAA
AATAGCGTGATCGGCCGCTGCTCATTATCTAGTTGTTGCGTAGAATAAACAGTTAGTTACATCCTTCCTGTTGCAATGATAAgttcgagcgggatgcttt
aAAAGTGCCCAGTAGGCTGTATCACGCACCATTGACGTTCATTTGTCTGGTGACGCAGCTTATCAAGGTGTGTTGTGCCTGAGCGCAGATCCGCTTCGAG
GATGCATTCGTCCGTAGTCGCAAAGCATGAGACCTTGGACGTGGTGAGCTGCATCAAACACTTGCGAGCGGTGATGGTGTGTATACATTATGATTAGCTA
TTCGCCAATATAGTCAAGTGGCTGTCGCATTGGAATGCATCGCTAAGAAGCAAGGCCTGCGGCTAGAATCCCGCGAAATTGAAGGTCATGGTAACATCGG
CCAgtacaaatgcatacgtatAGCGAAATTTGCCGCGATTTCCCGACCCCTTACCATTGTCCCTAAAACATGTGTAAATAGTGCTGGTCTGTGGTAGCTG
AGACTGTATTTAAGGCTGTGAGAGATAGTCTACTGTGCGCTTTCCGAATCCGGATCGGCCAATTTTACCGTTTCTGATACAGAAGCATTTGCTACATGCC
ATGTCTAATTCTAAACAGCAAGAACGACCAATCGCGTTTGAGTCTGGGCGACTTAAAGTTAAAAACAATAAATCTTATACCAAGGAGCTGCTTTCGATAA
AGTATCCTCTTGTTATGATGGGGGTACTCCTACTTGCGGTTAAGCCAATTGTGATCTATTCAAATCATGCGCTGTTGCGCACAGACTAAATAATGGTTAT
CTTTTCATGCCAATGATACCTTCCAAGTAGGTTACAGAATTGTGGTGGGAATGCACTTTTGTGTCGTTCGAACTGTGAAGTGTCACATGTCACAATTGTG
ACTTTGCCAGCTGATGATGTGAGAGCTGGTCGCGATTCGTGTTTCTTTTCCAGAAAGTAGGTTCATGAGCTCAAATTCAGCTTTATCGAAGCGTTCGCTA
GCACGTTTGCACTTTTATTCTAATACCGAGGCTTGCTGTGACTCTACACGTGGTCTTTTTCATGAAGATCCCATGTATAGAATACTGGACGAAGCACAAG
GTGTAATCTaatcaaaagaaaaaaacactATTCAACGGCGCTATGTACTAAATATGAATATGTTTAGGTGAAAAGCACTTTCATGCGCAAGTGCAAATAA
TGGTTTAAACTTTCGCCCCATGCGTTTTCGACCAACCTGTCGGTTCCGGTAGAATGTTGGCAATCTGTAATTTTGGACTTTTTTGGTATTCGAGAAAGCG
CTTGAACGATGGAATGCCTGAGAATCATAGCTTCtctgctgctgtcagcgattcCGTTGCTGATGTAGTTTTAGTCAAGCTGTTCCTAAAAAAACGTTTT
CCGCTCGCATAGCCATTGCATCGACATTAATAGCCATTGTATTTGCTTTACAGCATATTTTTGGCAGATGTAtccaaggtgctgggcaccaaattgGATA
TGTCATTACGCAAACAGAAGCTAGACGGAACGAGTCAATCGCATAGCGGCGGAGTTTCTCCTATGCTTTGTGCGGAGGGGTGGGATGATTTCTCTCATTG
GTTTTGCTCTAaagatgcagtgcatgcttTACCTCATTTAGTGAATGGTCTGTCTAACTCCCGTGATTTGTTGACATCTCGACAGTCATAGCGAGGGAGC
TGTGGACTCGCCGACATCGGTCAGGCTACACTTTGTGGCAAATCAATGTTTTTATAACAAGGACATTGAGCTGTATGCGCCGAGTACGCGACGTTATAAC
AGAAAGCCAGAATGTGAAGCTACTTGCCAGCTCCAAAAGTAGGCAAAAAATCATAAAAAAGGGCTTGGGCATTTATTTTTCGTGGTTGTACGCTACCTAA
ACATGCATTATGTGCAATCAATAAAATTGAGGTGCGACTGCGATATATCAGACATTATACGGTCGAGCGAACAGGCTTACCATTTTAAA