Description :
From Genome Similarity Track
Location :
Scaffold_691:9055- 10538
Sequence
1483 bases(100 bases per row)
GGCCGTAGCTCTTCGAGGCGCGGCGGCAGTATTTTGGTCAGAACGTCCGCTCGCATTAATTTTGACTCGCAGTAGTTGACGGTGATCACCTGTTTTTCTA
CAAAACCATTGATGAACTTGAAACGCACATCACTGTGCTTGGCTATCACATCACAACACGGATGTGATGTGATACCCGCTCCGATGCACATCATCTGGGG
GGATCAACCCTCGGCCAGAacacccccccccccccccccctcccccctaAAGGAGAAAAAGAATGAACTTAGCGGCCTGCGCTGGTTGGGCGGGCTGCTG
ATTGCTGAAATCGTCCTTAAGCACCCAAAAGTACCTGTTTTGTGTGTCCTCATCCTCTAGTAGCGTCACATTGTCGAAAGGAAGTACCTGAATGGACTTT
ATAGCATATAGCGCGGGAACATACGACCGTGGCTCTCTTCCATCTCGGGTTGCCAAGAGTCCGTCTATCCAAACTCGACCATCGCCGACTATGAAGCAGG
CGCGATTGTTGTTCCAGGAAACACCTTCGGGTCTCGTTAGCAACTCTTCATGCACTGTGTGGATGTCGGCCTTGGTTGACCACTCGAAGTCGTCGGTCTG
AAGCGGCGAGATAGGCTGTACCACTGCGATCTGCTTCACACTGAACTTGACAAGAGCTGGCGATGCAAAGGCACCCCCCCCATCAACTTAGTATGTCAGC
CCACACGTTATCTTCACCTTGCACGTGTTCAATAACGTAGCGATATGAAGTCATGGTCATCGCCCACCACTGCAATTTGTCGGTCTGTATCTCTGTTTCG
TACTATCCGTCGGAAACGGGTTGGACATGTACACGAGATTCCGATGGTCGGCAAAAAGATGAAAACCACTGGGTCGGAGCAGCAATACTGAAGACACTTG
GCCGACTCCCGATGGgaacgttttttttttgcgaTAGTGGGCCATCGACGATGTGTGTCAACAAACTTGCTCCTCACGAATGCGAGCGGGTGGTGTCCTT
GCTGGCCAAAAGGCTTGACCAGGTCGCATTCGTTGACCTGCGTGTACACGTCATCATAGTACTCCTGCGACGCATCTGTGAAGAGTCATACTGCGCTCGC
TGGATCGGGGCATGCCAGCGGAGCCATCGTCACAAGAGCTTCTCGAATAGCTTGTAAAGTCTCCACAAGCTCGTTTTGTCACCGGAGCTCAGCGAGAGGA
ATGCGACGTAGCTGCTTGGTCTTCCGGCTGCCAGATCGTTTAGCTGCTTCATCCATGACTGCTAGCAATGGAGATGCGAGCTGCGTGTACGACGGACTCT
TCTGCATCATTCAGTTGACAGCGCACATaagttgttgaagctggtCAGACCAGGCATCAAGACCAGATCTTCATAACGTGACGGATAATGCTGAACACCA
CTTGCGCTGATGCTTTTGCTACACCACTGCGTTTCACGTAGGAAAAATGACCTTTTCCCGGATGCAACTTTAGGCCAAAACGT