Description :
From Genome Similarity Track
Location :
Scaffold_17:90527- 102856
Transcript NameFunction/comments
Phypa_INRA-310PPTG_09054eukaryotic peptide chain release factor subunit 1
Phypa_INRA-310PPTG_09055hypothetical protein
Phypa_INRA-310PPTG_09056hypothetical protein
Phypa_INRA-310PPTG_09057autophagy-like protein 7

Sequence
12329 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNACTAATTTCGGTCCGAAAATAACATCCTCTCCATGTCCTCCTTAGCAATGGTACGAGCATGATCTCGCTGATTATCCCGCCC
AAGCAGCAGATCCCACTCGTAGCGAAGATGCTTGCGGATGAAATGGGTACAGCCTCCAACATCAAGTCCCGTGTGAACCGCCTGTCGGTGCTGGGAGCCA
TCACGTCGACGCAGCAGCGTCTGAAGCTGTACAACAAGTGTCCTCCCAACGGCCTCATCATCTACTGCGGCACTATCATCACGGACGAGGGCAAGGAGAA
GCGCGTGAACATTGACTTTGAGCCTTTCCGCCCCATCAACACGTCGCTCTACATGTGCGACAACAAGTTCCACACGGAAGCTCTGGGCGAGCTGCTGCAG
GACCAGGACCGCTTCGGATTCATCATCATGGACGGTAATGGTGCGCTGTACGGCGCTGTGTCCGGCAGCAACCGCGAGATCCTGCACAAGTTCTCGGTGG
ACCTTCCCAAGAAGCACGGACGTGGTGGTCAATCTGCGCTGCGTTTCGCTCGTCTGCGTCTCGAGAAACGCCACAATTACGTGCGTAAAGTGGCCGAAAC
AGCCACGCAGATGTTCATCACGAACGACCAGCCCAACATCTCGAATTTAGTGTTGGCTGGTTCGGCCGATTTTAAGAACGAACTTAACGGCTCCGACCTG
TTCGACAAGCGTCTGGCGGCTATTGTGGTCAAGGTCGTGGATGTGTCCTACGGTGGCGAGAACGGCTTCAACCAGGCTATTGAACTGGCTGCCGAGACCC
TCGCGAACGTTAAATTCGTGCAGGAGAAGAAGCTGATTGTGAGCTACATGGAGGAGATCGCCCAAGATTCGGGTAAGTACTGCTTCGGTGTGAGCGACAC
GATGAAAGCGCTAGACTTGGGAGCTGTGGAGACGCTCATCTTGTGGGAAGATCTGCCGCATCACCGCTATGTGCTGCGTAACGATACGACAGGCATAGAG
TCGGTCAAGATTTTGTCGCCGTCGGAGGAGAGCGTGGACTCGAACTTTGTGGACTCTGAGACCGGAGCTAATCTCGAGACGGTGGAGCGTGTGCCGCTGG
TGGAATGGTTCGCCAACAACTACAAGCAGTTCGGTACGACGCTGGAGTTCGTGACGGCGCGTTCGCAGGAAGGTTCGCAGTTCTGCCAGGGCTTTGGTGG
CATTGGCGGCATTCTCCGATGGAAGGTGGACTTCATGGAGATGGACTACGACGAGTTCGATGACGACGACTCGGACTTTGACGAAGACGCGTTCATGTAG
AAATAATTATTGCGTGACGCTTTTTTGCGCTTAGTTTTTTTTTAGGAAAGCAAAAGCGTCACGCACCGTGGCGCGGCGGAAGGAACTTGCGCAAAATTTG
ACAAAGGACTGCATTTGACACACGCAGACGTTCATAGCCGCTATAGATTTTTCGAGAGGAGGCAATGGAACGAGCTGTAAATACCCAAAGGCAAGGAATA
TACAATATTCCATGCGATTGCTTATGTTTTAAAGTTTTTTTATTAACTTTTTGGTGACGAAGAGACGTGGTTGCTATGGGTGAGGTTGATGCGACTGTGG
TCGAGCGTATGGAAGGCAATGTGGATGAGGTGCAAGAGAAGCGAGAACAAGAGGCAGCGGCGTGTTTGCAGCGGATGTTTCGTTGTCGTACGGCGAGATT
GAGACTGCGTGAAATGTTGGCATCCGTTTTTGAGAAGTTTTACGACGCCGACTCGGGACTGCATTATTATTTGGATAAACGTACGGGCGAGACAACGTGG
GAGAAACCTCGTGCACTTCGCAACGATGATATCGACTTGACAGCGGTATATGATGGGAAAGAGGAAGACACGTCCGAAGCTGAGCCTACAGAAGAAGAAA
GTGGTCTACAAGTGGTTGATCTGGACAATGACAATAAAAATGAAGAAAATGAAGAGAAATATCTAGGTTATTCGACACAAGATGTGGCGCTTGCTCGGGA
ACAATTTGCACACTACGACGCGGATTCTAGTGGATCTATCAATGCTAATGAGCTCCACAAACTCTTCACTAACCTCGGTGAACAACTCACGTTAAACAAC
GTTCGTGAACTTATTAAAGCAGTTGATAAGGACGGCAACGGAGAGGTGGATTTCGATGAATTTCTCCACTTGTTACGTAAGCAACAAGACAAGAATCGGT
ACTCAGCATCATTGACACTCGCGTTGCTCTTTGGACCCAAGGAACTGACTAAACTCAAGCAACAATTCATGATTCTCGACTTGGACGGAAGCGGATCCAT
CGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNACGTGGGAGAAACCTCGTGCACTTCGCAACGATGATATCGACTTGACAGCGGTATATGATGGGAAAGAGGAAGACACGTCCGAAGCTGAGCCTACA
GAAGAAGAAAGTGGTCTACAAGTGGTTGATCTGGACAATGACAATAAAAATGAAGAAAATGAAGAGAAATATCTAGGTTATTCGACACAAGATGTGGCGC
TTGCTCGGGAACAATTTGCACACTACGACGCGGATTCTAGTGGATCTATCAATGCTAATGAGCTCCACAAACTCTTCACTAACCTCGGTGAACAACTCAC
GTTAAACAACGTTCGTGAACTTATTAAAGCAGTTGATAAGGACGGCAACGGAGAGGTGGATTTCGATGAATTTCTCCACTTGTTACGTAAGCAACAAGAC
AAGAATCGGTACTCAGCATCATTGACACTCGCGTTGCTCTTTGGACCCAAGGAACTGACTAAACTCAAGCAACAATTCATGATTCTCGACTTGGACGGAA
GCGGATCCATCGACGAGCACGAACTGCAACAATTAGTCAACAAATTGGGACGTCGTGCAGAAGAATTCGATTTACCGGCTATGCTGCGTGAGGTTGACGG
CGACGGGAGCGGCACCATCGGCTTCAATGAGTTTCTACAGATCGTGGCAAGTATGACAAAGAGCGATGGCGGTCCTAAATCTGCCTTTGCCGTTCTACTG
GATATGGGTATTGCACAAGGACTACTTAACGGATTGGATGAGGTGGTGCAAGCTTCAAGGCAGAAGGTCTACGAATGGCTCAACTCTGACCTCGTAGCAG
AGCAAAAGCGACTTCAAGGGAAGCGGGAGCGTCGACGACGCCAAGAAGAAGAACGACAGCGTCAACTGGCAAAAGACCAAGAGTTATACGCTAAACACCA
GGCTGAACTCGCTGCTATCGAGCGAGCGCGTCATGCTCAAATCGAAGGTTTAATGATCGAAGTCGAGTTCGAAGGTGACGGTCGTAACTTTCCACTTGCA
GGACAATTCGCGCGTGTCCACTACGTCGCCAGCTTCGAGCGTACAGGAGAAATCTTTGAGTCTACACGCGTAAGATGTGGCAGTGCACTTGAGTTCTGCG
TAGGTGCTGGTCATACTATTCAAGGATTCGACTTGGCCTTGCAACGCATGAGTGTTGGCGAGACGGCAAAAGTTACGATCGCTCCTGCACTGACTTACGG
CGTGAAAGGCCGGCCACCTCGAATTCCACCCAACTCTGCGCTTGTGTTCCGAATTGAGCTCATTAGCATCAAGGAGAAGCTCCAATCGAACGAGATGGCA
CCAATGACACCTCTGGAGCGAGTACGGAACAGATAGCCATTAGGCGGCCAAAAGTTCAGAATCTCAGCTCAGTGTGGCGAGTTTGACTGGCCATTTACAC
ATCTTCGTGCACAAGAATCGGTAGATGCACCCGCGTACGTGTTTGTTGGCGTCTTATTCGTGTTCCATTCACATTCTGGTGGTCACGAGCTCAAGTCGTC
AAGATCACAAAGAGTTGCGATGTCAAATGACAAGGATAGTGTTATCTCTTTCTGGATTCCAAGATGCTTTCGGCGGAAGAAAACTCCACCAACTGTCGAG
ATGATTGGAAACATATTCGAGCAGCGGATCATGCAGCGACTAAAGAAACACAAGCGATCGTCAAGACTGAAGCACTCACGACCTCGACCTATTAGCTGTG
AGTTCAAGACACTCGACGTACCAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAAAATACCATGCCGGTGGTTCTGTGGATAGGTTTAAGGCAAGATTAGTTGTAAGAAGGAATTGCCAACAGTTCGGGATTGACTACGGTGGACTA
TTGTCATCATTGCAGAAGTAGCAGCCCAGCGATGGTTTAGTAGCGTCACCATCAGGATGAACGCCATGACGCATCACAAGGTAGCCGTCGAAGCCCAACG
CTGCATTCAGAAATAGTTTCTTCTTGGACGAGGCGATCACAGTGGGAAGCCAGCGACTCTCACGGGAGTCTGTGCCTAGAAAGATGACGTCATGCGACTC
GATTAGCTGTTCCAGTGTCTCCAATCCGATTCTGGCTTCGTCCATCAACTGGGGGCTACTCAATGCATGTCCTGCCATGGGGATTGTCAGATTCACTGCC
TGGGAGTTCACGAGTGGGAAAATGCGCTTCAAAGCGTTAGCAGCGCACTCGCCCTTGGGTTTGCCGACGTCTTGGAACTCAAAAAGTGGCTGGCGAACAG
GATTCGAGTGACTCACAGTGGAGTTATCCACAAAGGTGATGTTGCGGAAACCCCACGAGAGCAGACTGCGAGCAGTATAGCAGCCGAGAGTCCCTGCGCC
AAGCAGCAAACACTTGGTCTGAGCTAACAGCTCCAAGTCCAGAGACGGCAATTGACGCCACCTCATCAGCTTGAGATTCAGATCCACCGACGTCTCTGCG
AGTCGAATTGGGTCCAAAATGCCTCCAAGTTCCATCACTCGAGGTCCCATTTTGCCGCGAACGTTCGCTTCCCAGCCCATAACACGCACATCTTGTCGGG
ACCGGCCGTTGGCCATGAACGGCTCGCTTTTGACTTCAAAGATGACGGAATTTTTCCACTCGAAGTCTTCAGGGACGTCAGTGAACTGATGCACATGCTC
TCGGAACGAAATGATCTTCAGGGGTTGCGAACAGTCCACTTTCTCACCCGGTAGTGCTGTCAAGAGCGCCAGAAAGTTGCGTAGAGGCCACCCAGGGTTC
GTCTTCAATGGACAAGGGTCGACGAAGCCGAAGAGCGTGTCCACTACGTCTGTTGTGGTATGATCTGCTGCTCTCCACGTCTTAATATCCAAAACTCTCA
CGATGCAGTCACTATTTGCCAGACGTTCTACCACGAAGAAGGACGCAAAGTTGCCCTCCACTGCACCAGTCTCACAGTTCACTTGGCGCAACTTAAGCAG
ACCTCGAAGCGTCTGAACCTGCTCTTTGGACGACAAAACCGAGGATACCGACGAAGGAGGAGATCGATACTGGAATGAGGCTGGGGGAGACAACGCCGGA
AAGCCGAACCAGTACAGGAAGGAATGTTTCTTGAGGTCGGCAAAAGTGATCAACACGAAGCTGTTTAGGTGGTCGGTGGAGATGTCCTCGTCCTCGTTCC
CAAGTATTAGATCTAAGATCTTGTCTCCGGCATCTCGAAGCAGTTTGGCCTTGTCCAGCTTCTTAAAATCCTGCATTAATAATATTAATTGTAAGAGTCG
CATCGTCTACTTGAGGGAACATAAAGTTTAGTAGTTCACCAGCACCAACCTCTAGGGTATTTGTGTTGAACAGCAGCCCAGGGGCTTGCCACTCGTATCG
AGCACGATCCACGTCCCTACCAACCCACATATAAAATATGAGACTCGGTTGGATCACATATTTTATACCGTGGCTTTACCTGCTCTCTTGGGTCCCTTGC
GCACTAGCAAAAGCACTCTCGTCGATAGTGAAGCGTGCAGGGACGTTCACGGACCTCCCTGGCGTAAAATAACCCGTAATGTCCTGTATACACCATCGGT
TCGAAAACTTAGATTCTTGTTGCTCGCTTCAATTGCTGTGCGCGCTTACTTGTGCCTGGTCGTTCAGCTGGAACTTGTCAAGCTTGAGCGACGCGAGCGT
CTGCCAGAAGGACACGTCCGGCGCGCTGTTCCACGGCTGAAACTTGAGCACCTGCCAGTCTACTACGGCTTCTGTCATATTGTTCTTCGTCTGATCCTGC
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGAGCAATTTTTAATAACGTACTAGTACGTCTATGAACGTTGAGGAATTTCCATAATACAGTACATATGTA
CTGTATTGTCCCAAAATCGAAAACTAGTT