Description :
From Genome Similarity Track
Location :
Scaffold_152:90508- 96297
Transcript NameFunction/comments
Physo_143806hypothetical protein
Physo_143807hypothetical protein
Physo_1095903-oxoacyl-(acyl-carrier-protein) reductase
Physo_143809PREDICTED: similar to spindle assembly abnormal protein 6
Physo_143810hypothetical protein

Sequence
5789 bases(100 bases per row)
GTTGCGCGTCTTGACGGACGTGGCGCTGCGTCTGCTGAAGGACTGGCGTGAACGCAAGAGTTAGTTGGCCCAAAGGACGAGAGGGAGGGGGGGGGGGGGG
CGAACCTGGTGCGTGCGCTGCTGGTACTCCTTCATGTAGGCGAAGAAGTCGTCCCACGAGACGAACTCGCGGCGCTCCATGGCGGGCGCCTCCCAGAGCT
GCCCCGCCATCTGCGCCATCGCTGCTTTGAACGCGCCAAGTCCCTTTTGACAAGCAAAGGGGGCCATCATTAGCGGACACGGTGGTGGTGTACTAACTCT
TGTTAGATTTAGTCAGTACATTTGTCTTGAACCTTATCGGGGTTAACGTTTGTGGCGATGCCTACAACATGTAGACATCGTATGTGTCTCTTTCTTTCTC
TCTCTTAAGCTTAACAGCAATTTACTGAGCAATGAACATGGAGGACGGCGACGGGCAGTCGATGGAGTGGCCGGTGTACGTGAGCTTGCCGGTCTCGCCG
TCCGCGCGGAACACGTCGAGGCTGCTGGTGTCCTGGTTGACCGCCAGCACGAAGTCCTTGTACACGAGGATGTCGCGGGGCGTCTCGCCGCGCGTGGGGG
GGATCTCCACGAGCTCCAGGCGCGTGTCCGGCAGGATCTTGTAGATGGCGATGCTGTGGCAGAAGCGCGTGGCCGCGTACACGAACTTGCCGTTCGTCGA
GATGTGGATGTCGGACGCCAGCGCGGTCGGGCCCGAGTAGTCCTTGGGTATAGTCGAGATGATCTGCAGCGACTCCGAGCCCAGCTTACCGGTCTTGGCG
TCTAGCGCGTGCACGCTCACCGTGTTGTCCAGCTCATTGATGACGTAGCCGACGCCGAGCTCGGGGGACAGCGCGAAGTGGCGCGGGCCCGAGCCAGGCG
CGCTCGTGATGAACTCCTCGTCCACGAGCTTCTTGTTGGCGGCGTCCAGCTTGTACTGCACCACGCGGTCCGTGCCGAGGTCGGCCGCCACGAGGCCCGT
GGGCGTCCAGGCCGTGCTGTGGATGTGCGAGGCTTCCTGGCGGTCCGGGTTGACCAGACTCGCGCCTTGGAAGCGGTGGTGGTCCGACGCCGGGGCCAGC
GAGCCGTCCGCGTTCACGGGGTAGAGCGAGAGGCTGCCGCCGCCGTAGTTGGCGACAGACACGAAGTCTCCGTTGGGGCTGAGCGCCACGTGGCACGTGT
ACGCGCCGCCGGTCTCGTGGCGGCTGATCTGCGTCAGCTCGCCGTCCTTGCCCATCTTGTAGGCGGTCACGAAGCCCGTCTCCTCGCCGGGGCGGAGCTG
CGACGGCTCGTTGCTCTCGTTCACGGCGTAGAGCGTCGATCCCGAGCCGAAGACGTAGGACGGGTTGATGCCCGCGCCCTCCGTCACCTTGAGCAGCTTG
AGCTCGCCCGAGGCGTCGTCGAACGAGTAGGCGTTGATGCCCTTGGCGTGGCCGTCCACGTGGCCCTCCTTGCGCGTGTACGTGCCTACGTAGAGGGTCG
GCATTTTGGGCTGCTGGTGCTACTTGGTGCTTGGAGGGGGAAGGAAGATCCGGAAGTGAGCTCTCTGAGGCGAGCCCTCTGCTCTGCTCGACGCGCGCAA
TTGACGTCAATCCACGCACTTTTGATGATCTGGTTCAATGTTGCCGCCCTGTTTATGCTGGCAGGGGCCCGATAAAGTACGAGAGCTGACAGTACAAGTA
TGCCAGCGGGTGTGGCGCTCGTGACCGGAGGCAGCCGCGGCATCGGCTTCGCCGTGGCGCGGCAGCTCCATCGTCGCGGCTGGCAGGTGGCCATCACCTC
GCGCGACTTGACGCGCGCGCAGGAGGCCGCGCAGCGGATCTCGCCCGACGTGCTGCCGCTGGCCTACAGCTGCCCGCGGCGTGGCGAAGGAGACGCCGGC
GCTGAAGCCGCGCAGTTGGTGGCTCAAGTGGCCAAGGGGCTGGGCGCGGGGCCCTCCGCGCTCGTCAACGCCGCCGGCATCTCCAAGGACAGTCTGCTGC
TGAGACTGAAGGACGCCGAGCTGGACGAGCTGCTGCTCACGAACCTCGTGGGGCCTGTGCACATGTGCAAGGCCGTGGCCAAGGGCATGCTGCAGAGGCG
CCAGGGCAGCATCGTCAACATCGGCAGCGTGGTGGGCGCGGCTGGCAACGTGGGGCAGGTCGCCTACAGCGCCTCCAAGTCGGGGCTCGCGGGTGTCACC
AAGTCGCTGGCCAAGGAGTTCGGCAACCGCAACATCCGCGTCAACCTCGTGGAGCCGGGCTTCATCTCCACGGACATGACGGACGCCATGGCTGACGCGG
CGCGTGAACGCGTGCTGGGCAACATCCCGTTGGCTCGCTTCGGGAAGGCGGAGGAGGTCGCGCAGCTCGTAGCGTTCCTGGCGAGTGACGAGGCGTCCTA
CATCACAGGACAATGCATCCGCATCGACGGAGGACTGGTCATTTAAACTGGCAGGGGCTGGAAAGGTCTTCTCTTGTGAGGTGCTGGTGCTGATCTGTTG
CCATCGATGGAGGCAGTAGATAGAGTACGGGGGTACTGGAGGTTAGTGGCTATGCTACGACTGAAGGGTGGAAGCGAAGTGTGTCGTTGCCCTGGACTCC
GAGGCGGTATTCTTCTACAAGACAGACAATGTTAGGCAGAGGTTAGCGTGACCATCTTCCACTGTGCTTTTTCAGGCGCTTTCTTTACCTTATCAGACGG
ACGGAACGCGAGCACAGAGGGGTGTGCTGTCGACCTCCGTTGGTGGCCAAGCTGTGCTTCGTTGATCTCTTTGTTCAGCCATGCGATCACTGTACGGAGA
GGCACGCGTATTAGAACGCAGCAGCAACAAATGTCGTGGTACAAGTTGAAGAATTGGAGCGTACCTTGCTGATTGGAGGCCAGAAGCTTGTTACTGTCCT
CTAGCTTCTGACTCAGCTCCTTTATCGTGTCCTGCGGTGAATAAAAAAAATAAAGTAAGTCATAACTGCTCAAAGGCAAAAAGTACCAAGAGTTTCTTTG
CGAACCTTGAGCTGTAAAATGTGCTCGTCCCGCTTGCGAACATCTTCCTTTGTCGACTTCAGCTCCAATAGCGCTTCCTCACGCTGAAGTTGTTTTTCCT
CGACAAACTGTAAATTCACATACGATAGTGAGAGCACGGACTTTATCAAAGGACTACATGCAGCACTAAGCCATCGCACCTGCTCCTGCTGTTTGATAAT
CTTGGCCTTCATCCTCATCTTGGACTTCAGCGTACGATTTTCGTTTTGTATGCGCTCGATAATTTCATTTCCCTGTGCAACAGTCACCGCATGAGAATTT
GACTATACCTAGCTCATCAAGCCACCAGTCAAATAAATAAGGCCATGCCTGCTCACCTTATTGATCTCCGAGATGCTCAATTCCAGCTTCTGCTGCAACC
GCGCGTGATTATCTCGGTACATTTTCAGCGACTCGTCAACTTCGTCGTTGTGAAGTTTTGCCGACTGTAGCATTTCCGTGGTCTTCTTGATCATGTCCTC
CTTGTCCGCCAGTTGCTGTTGCAGCGCGTCTGCCCGAACCTGTAAGGCATTGATCTGCTTCTCCTGCTGGAATACCTTCTGGTCCAGCTCTTTGTTTCCA
GTACGCAACTCATCCACTTCGCTGGTAAGCGCGCTTCTGCCTTGAGTGAGATCCTGTGACTGCGCGCGCAGGTGATCGATCTGCATTTCATGCTGGTATT
TCTGCTTGCTTAGCTCCTGCACTTGCGCTTCACTCGTCTCGGCGGTCGCCTTCAGCTCTCGAATCTAAGCGTTTCAAACCAAACTTGGTACGTTAGCATG
AAAGGAAAACTCCGCCACGACAAACAACCGCACCTCTTTCTCGTATCTTTCCACCAGCACATCGATCTTGGCATTGAGTTCGTCCTCACGCGCTTTCAGT
GCAGCCGCTGCATTCTTACGTTGGGCATCCAACTCATCCGCAAACTTCATTTTCTCTTGAGAAAGTGTGGACTCCGCTTCATATCCCAACGCCGATAGTT
GCTGCTGCAACGTCGCTTCACTCCTCTGCGTGGTCTGCAGTTCCTCGCTCGTCTGCTTCAACGAGTTCGACAGCATCCGCCTACTCGCTCCCACCTGGGC
CAATCTCGCCGCCAAATACGCCTTAATCACCGCGTCATCACCCGGAACGAATCTCAGCGACAAATGCGTCAACTGCTTGAACGGGTTCGTCTCCACGATG
CTAAACACCGACTGTCCGTTGCTATCCGACGTGTTCAACACCGCCAAATAACTATAAAATATGCGCGCACAAAATAAAACATCATCAGTCAACCGAAATC
ACTAAAAGAAATCGATGCACCACCTCCGCATACCTCAACGGCACTGGTCCCGCAGATCTGGTCTTCTGACTGCCTTGAGTGGTCTCATTTGCCACTTTGT
TCACCACCGGCGCGTCCCCCTCGGCCGAAACTTCAGCCTCTCCCTCCTTCTCTTCTTCTTCCTGTGCAATTTTCTTGCTGTCCTTGACGCAGCATTGCAG
CAGCTCGATGAGGTTGGCAGGGAACGTGGCAAAGTCCACGAGCAGCCTCTGCTGCGTCTTGAGCTCGTGGAACTCCTCCTCCGAGACGCTCCAGAGGTAC
AGGAAGTACGGATCCGCGCCGTCGTCGTCCGTGATCTCCACGCGCATCACGCGCTCCTTCTGGTTCTTGGCATTATTTTGCTACACAAGAAGAAATTATG
AAAAAATAACAATCCAGATTCAATTGAGTTGAGAATAGTTTTGTATCGCTGAAGGGGGAGGGAGGACGCACCCGCACGCCCGTGAGCAGGCGGATGGTGA
GCGGCAGCAGCTTCTCGTCGCGGCCCGGGTACTGCACCAGCACGTGGAAGCGCCGGTCGAACAGCGGCGCCTCGCGGTCGAACTCCTCCATCGTGCTCGA
GGCCAAAAAATCGTGAATTCAAATTTGAGTCAAAAGCCGAAAATTTGAGTTACGAGCAAAGGAGAAAATTTGGCAAAGTGTCGAATGTACAGTATTACCA
ATAATATTAATACAGTACATGTTGAGCTCTTCCTATCATGGCACTTCATGTTACATGAAGTGAAATGAATCATGTAAGCTTATCCATACATGGCATGCTC
CTCCACTGGAGGAGCATGCCTCCAGATCAAACCACAGGGATACTATGTATTTACAGGTTAGTCATGGAGGTGTTCTTATCAACGCAGATCCCCACCAGGG
CGTTAGCATCAATATTACCTGGAACTGCAGCCCGGAAAGTCCGCATGATCATTTGTGTCATTAGACTTCCGTCGAGTTGACAGCATTTGCTGCTCTCGTT
TTCGTTTTCAAGCGCAACAAACCAGCTCCGTGCAGCTAAGCAAGGAATACGTTAAGGGAGGTTGTACAGTATCCAATGCATTGAAACAGATAACGCGACC
ACGGCACCTGGCCTTCCAGCCTCTAGATGCTTCGAAGACGGCGGCCAGCGTGGGCGCTCGCAGACACGGCACCATTCGTACCGTGATCAGCAGCAGCGTT
CGCACCGACACCGGCACCCGCGCTCGCTCCAACGCCGGCACCGCCATTGAGCCCAGCTCCAGCGTTTAGGCCTGCGTTAGCTCCAAGGCTAGCACCAGCG
TTCAACCCAGCACCGGCATTGAGCCCCGCACCCGCGTGGAGACCAGCTCCAGCATTCAGGCCTGCGTTTGCACCAAGGCCAGCACCCGCGTTCAAACCTG
CGTTGGCTCCAAGCCCAGCTCCAGCGTGAAGACCAGCTCCAGCATTCAAGCCCGCGTTGGCGCCTAGGCCTGCGCCAGCGTTCAATCCT