Description :
From Genome Similarity Track
Location :
contig_43:90505- 92368
Transcript NameFunction/comments
g7457.t1hypothetical protein

Sequence
1863 bases(100 bases per row)
CATACCAGAGCAACGCAGCTGGTCCACAACGTAACCATGGTCGAAAACGCCAGGCGACATCGTCGGGTTCGGCTTAATACACCGAATAAAGTTGCAGCGC
GTTGCATTTAGCGTGTCCGTCAGCTCCTGCATCTGATCGCAGAACTTGGCCGACACGCTCTGCTTGTGAAGCTGACTCAAGTTGGACGCGCCATTCATCG
AGTCCAGGTCCAGCTTCGACGAGAACAGCTCCTTAATAAGCGAGGACTTGCTAGACGTCACGAAATCTTCCAGGTCCTTGGGAATCGTATCGTTGTTCTT
GTCGATGAAGTTGCCAATCGTGTACGGCACACGCGTGGCGAAGTGCTTGACGATGAACTCGTACTTCTTGTCCTTCTCGTGAGGAGGCAGGAAGTGAGAG
TGACCCGCGTGCGTCTTGTGCAGCGTGGCATTCCACTTCTCGTCGGACGGCTTAGGCATCTTCGCTTCCTGGTCCAGCAGCGGCAGAATACCATTCGGCT
TCTGCGAAATTAAGTCGATACAGTCGCGGTTATCGGGCCACACGATCTTGCCGACCTCAATACCTTCAGCAGCGAACAGCTCCTGCTCGGCAATAAACAC
CTGCTGGTTGAATGTGGCCTGCAGGGCCTCGTTAGCGTAGTTAATCAGCAGCTGCTCAAAGTCGTTCTCCTCGAAGGACTCGAAACCGAAGATATCGAGC
ACACCGATGAACGGCAGCGAGCTATCACCGTGGCCAAGCGACGTGTTGATTCTGTACAGAATCCACTTGAACAGGTGGTTGTAGATGGACTTGGCGATAG
CGTCACGCACGTAGCTTCCCTCCTTCGCCGTGCGTTTGATCGTAAAGTTCTCCGTACGCGTCGAGATCTCGCGCGTCGTGATCACATGCAGCAGGTTGGT
GCTATCCACACCGAGCAGCTCCGCGCACGACGCCACGTACTTCTGCGCCTCCGGAGTCACCTCGCCAGCGTCGCCCTCCGCCGTCTCGCGGTCTTTCAGG
CGAATGTTACCAAGATGCAGAAGACCGGACAGGATCGTCCAAACCTGCTTCTGCAGCGCCGCGTCAATGTTCACAGATCCCAGAGCGCTCGCCACCTCGT
CGAACAGGATCTCATCGTCCACATTCGGGTCCGACACGCAGCCGCTCTGGTTCAGGTAGTCGAAGTTGTTCACCGACTCGAGCTTGAGCTCCTTCGTCAG
CGCCTGGTCCGCGCCGGACAGCAAAAAGTAGAAGATGTGGAAGTTTCGCTCGCCTGGGATTTGCGCCACCACGCGGAACTTCTCGAGCAGGTAAGTCTCA
ATGAACGCGCCAGAGAGCGTGTTGTCGCCTGGCTTGAACTGCAGCTTCATGAACTTGCCGAAGCGCGACGAGTTGTGGTTGCGCAGCGTCTTGGCATTAC
CGAAAGCTTCGAGGATGGGGTTCGTGTCCCAGAGCCGCTTGTCCAGCTCCAGCGCCAGGTCCTGCTGGGCGTCGTTGCCCTTATTGGCCGTGAAGGCCAG
GTGTTCCCGGGACGTGAGGTACCGCAGCACGATCTTGGACGTCTCGGTCTTACCGGCTCCGGATTCGCCCGAGATGACGATCGACTGGCACTGCGCGGGC
GTGCGCAGCGCCATCTGCTGGAAGGCCACCTCAGCGATCGAGTACGGGTGCGGGGGGCGGTCCCCCATCTGCGTCTTGATGTAGTCCGTGACCTTGGGCT
CCACCGTGCGCACGAGCGGGTTCACGGCGATGAGCACGTTGGCCATGAGCGTGTAGGGCCTCAGATTGTCGGCCTTGGAGCGCACGAACAGGTTCTCGAG
GATGCCGGCCTCGTGGATGTAGTACAGACTCGTCATGTCGTCCACCACGCGCGGGTTCACCTT