Description :
From Genome Similarity Track
Location :
Scaffold_1889:905- 2046
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_1889-abinit-gene-0.10Structural maintenance of chromosomes protein 5
Pytiw_DAOMBR242034maker-piw_contig_1889-snap-gene-0.4Structural maintenance of chromosomes protein 5

Sequence
1141 bases(100 bases per row)
CGGCTGGGCGCTCAGCAGGAGCGCGTCGAGTTCGCGGCCAGGCAGCTCAAGCGTGCCGGGCAGCGGGTCAGGTTTGTCATTGAGCTCTTGGTTTTGATGA
AGTGATGCTAATAGCTAAACTCGATCGCTGACCATTCATGTGTTTGCCTATCAATGGGACAGAGGGATCTAGGGTACGAAGGGCAACCTCATGTCGATCG
CGAAGAAGGCAACACAGTTACAGCGCCAGATCGAGAACGGAACGCCCTGGGACGAGTACGAGGAAGCGTTTGGCAGGCTCTCGGACGACCTCGAGGACTT
GCGCGGGTGCATGGAGAACAAACGTGCGTCACTCGAGTGTTTCTGCGGCGATATCAGCGTGCGCGAAGTCTACAATCGCGTCGCGGCCGAGATTGAGCGC
GAGGAGACCGACTTGCAGAAGCTCGAGGACTTTGTCACCAACGGCGAGGACAAGGTGAGCACGATCAAGGAGTCGTGGCACGCCAAGCTCCAGGACGTGG
TGGCGCAGATCGACTCGTCGTTCAAGGCGTTCTTCGGGGACATTAGGTGCGTGGGCGAGATCGTGCTGGACGACGAGGACGCGGCATCTCTAAGTGGTGC
GTCCAGCGCCGCGCGCAGAGCACCGAGCTCACGACGATGACGGCCGAGGAGCAGTNNNNNNNNNNCGGCGGCGAGAAGTCCGTGGGCACGATCATGAACT
TGATGGCGCTGCAGAGCCTCACCAAGTGCCCGTTCCGCGTTGTGGGCGGGATCAACCCGTGCATGGACTTGTACAACGAGCGCAAGGTCTTCCAGCGGAT
CATCGAGTCGATCTGCGGCAGCAAGTTCCCGCAGTACTTCTTGATCACACCCAAGTTCGTCACGGGGCTGCAGTACCACCGCGACACCAATGTCATGGTG
ATCCTCAACGGACCCTGGAACAAGATCTAGCAGGTGTACTGGGACGCCAACAAGTTCGTCGCCTAGCCGGCATCTCAAGCGAACCGGGAGTGGTGGTGGT
ATGATGCCAGCGAAGAAGCGGCGCGTCAAGGTCGAGACTGTGGGTTGAGCGGCATGGGTCCTTGAGCTGTAAGACGGGTGTGTGCTGTAGGAGTGAGAGA
GTTAGCTAGAACGAGTGTGACTTGTAATTGACTCAATTTTT