Description :
From Genome Similarity Track
Location :
Scaffold_8:904978- 909305
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05881polysaccharide lyase

Sequence
4327 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTGCTCTTGCGACGACGGAGTCTTTGCTGCCTTGGAAATGTCCTCGTTGATGTGAACGTCGCTCTCCGAGTACTG
GCACAGTGGGTTGGACGGACCGTGGCCAAGCATCTTGGGCTCGCCGTTGGCGTTACCCTGTGACCACTGGCACACCTTGACGGTGGCCTTGCTCGACTTG
ACCCAGACGTTGCTGAGTGTGGCCTGGTCGCCCCAGTTCTTGTTGACTGTCACGATGGCGTTGGTCGGGTTGAGGACGTACGTGTTGGACACGGACACCT
TCTTGGGTCGGTTGCCACAGGTGCCGCATGAGCGGTAGAGCTTGCTGATGTCCTCGCCGTAGAAGCCGTCGATCTCGACCGTACCGAAGCCGTTGTGCTG
GATGACCTTATCGTCGGCGTAACGGGCACCGCCACCGATGACCTTGGTCACACTGGACGCAGTTCCGCCCTTGACACTGAGAGCGTCCTCGCACACATCA
TCCCACCACACGTTTTCGATAATGCAGTCATGCTTGTCGCAGTGCACGCCCTCCATTTGGTTCTTGCCGATGATGACATTCTTGAGGTGGCCGCCGGCCT
CCACTTTGAACACCGCCGTGTCCGATCCGCTTTCGGTTTGGCCCTCGCACGACACGTCGGAGCGCTCGAACGTCTTCATCTTGCCGTCGAAGACCTCACC
GGCCTTGACGATGTAGGCCTGCGAGTACTGCACGGTGCCCTTGCTGGCGGGCCACGACCCATTCGGCAAAGAAGCGGAGGTGGCAACCGCAAGGAGGAGA
GCGGCAGACGTCACGAACGACGCGAAGGACTTGACCATCTTGGACTGGTGTGGGGGTGCTTGGCCACTTGTTGCCCGAGAGGCGAATTGATTAATGAGCA
GAAGCAACTCAATCGTTTTAGTCACAGCGACCACCAAGGAGCCATGACCGTGTGTAAGGCGACGCGACTCGGCGGCAACAGTGATGCGGTTTACTGACTG
GTTGCAGTCTCCATTGCAGACTCTCCATTGCAGACTCTCCATTGCAGACGCTATTCAACGTCGTAAAACCGCAAAGATCTGGAGTCCCAGTTGTTTTCCC
GGGGTCATGCTGCTGGTTGCGGTCTGCGGTGGACCGAGGGTTGGCTCGTTTTGCCTAGAAGGCAAATCCGTGACGATCGATCATCTCTGTGAACTTGACA
CGGCCGGTCAATGCTGTGGTAGCGACTTGACGCTTTTTGCTATTCGAACGGTGCCGTTTTAATTTGCTACTTCCGACTGGTACGTGTGTCGTGGGCGTTG
TCGTATAATAGTACGTGGGCGTTGTCGTATAATAGTACGTGTATACTACGACAACTCCCACAATGCATTACTTTGGAAGTGGTGTGGCTGAAACTCTACG
TTCGCGAAGGCGTGCATTCTGTTCAAGTCTTGTCCTAGCTATTGAGTACATGTACGGTACTAGAAATTGTTTGCGCTTATTAATAGACCCGAGCCTTGGC
CGTCCAGCAGGTGCAGGCTAAAAAAAAATCGATGGGGATTACTCCCGAGTCGCCCGTTCAGTCTGGCGCGAAGGAATCTCCTTCTTGACCTGGCAATCAT
CGCTTCGCCCCGGTTGGGCGTTACGTTGTCTAGTTCGAAATACCATGTGTGCCCGGGCTTCAGATCCTGGCTGATCGTTGTTTCCTCCCTTTCGTACAAG
TTGCTGCCACGTTGATTCAATGCATGAGGGCAGGTTTTCGTGAGATTATTTTGGTTGTTTTGCCTCCAAATGCATGGGTGACGAAATTGGTGTATTCGTA
CGGGCACTTCAATAGCCTGCGAAGCAAGGTTGCATTTGAGTATTCACTGGAAGTGGAACGATTAAGGTAAGGCGTTTAGCGGGTGCCTGTGATGATCAGC
TCATTGAAAAGTGTACATGCTCGCATATCAACACTTCCGTTCTTCACAACGAAGAAGCTGATACAGTATATGCATCGCACTCGTCGTCGTGCTGTTCGTG
TAGGCAACAGCGGAGCACGACTTCGGTGGGAAACCTGGGCAACCGATATTGAAATAAACGAGGCTCCCCTCGTACTCAGCGCGTCGCCGTCCACAACCTC
GGTGTGGATGGATACCCACGCATGGTGCTCGAGAACATCATAGATCGGCGATTAACACGACTAATGCAACAGATGCTTCAGATCGCTCGTGCGGACAACA
AGATGGTATGCTCTATGTGTTTATTTGGTAAAGTATACCGTCTATTTCTCAATATACTGTCTATTTTTCAAAATAGTCGGTATTCCTAATAAATTTAAAT
TTTTGATATCTTTTAAGATAAAAAAGATTTTTCTGTGTAATACAGAATACGATTATTTTGCCCAGCTCCATTGTTATATTTTGTATGATGTGCAGAGTGT
TGGTCGGGTTGAACATTTACAATAAAACAATCGAAGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN