Description :
From Genome Similarity Track
Location :
Scaffold_94:90490- 92063
Transcript NameFunction/comments
Hyaar_Emoy2809096calpain-like protein

Sequence
1573 bases(100 bases per row)
TCGCAGATCAGTGGCACCAGTGATTACGTCATCATCTGGGTCGACTTCAGCGTCAAGTTACAGTGCGCCGCCGTCTTCCGGACCTTCAGCTCCTGTCAGT
TTCAAGTGTGCGCAATGCGGAGAACCGTTCGGAGACTCCACCGCCTCGTTCTGCGGCGAGTGCGGCGCCCATCGTCCTGCAGCCGCCGCAAAAGTCCCAA
GTGGGGAGATGGAGAATCTCTTCAGCGCGGCTTCGACGTCGTACACAGCTCCAGCTCCGGGGGCTACGACGCAGTCTGGAGGGTACCAAAAGAGTGTCTC
CTTTGCATCGCCTAGTGTGAGCTACACGCCGCCCTACGCTGCATCACCTACACCAGCAGCTTCCAATCCACCTTCTGCCACTCAAGACCCGTACGCTCCA
CCTGCTGCCTCTCCTGCATACAACCCGTACACCCCACCTGCGTCCAACCCGTACACCATATCACCTACAGCCTCTTCCGCGTCGAACCCGTATGCCCCAC
CTGCTGCCCCTTCTACGTATGATCCGTACGCTCAGCCACAGACATCGGCACAATTGGCTGAGCCGCCGGCCTCGGTGGACGTGCAAGCTGCTGCCGCGTC
TGGTAGCAGTATCAGCAAATTGCTTGCAAATCTCTCTGTGAGCACGAAGCCCAAAGAGGAGAGAGAAGAACCGGATGGAACGGGTGCCGGAATTCACATC
CGACAAGTCGTTCGTGCGCGAAACATGGATTCGCTCAGCACGCGATTGGAAATTTCGAATGCTGTTGAACGTAACCGCGTTAATCCCCAGGAGCGCAGTG
AAGGGTACAACGTGACGAAGGTGAATGAGACGATTACGGTGGTGCAGAATGAACGTGCGGATCCGGTCGAGGAGCGCTACTGCAATCAGCACACGCTACC
GGACAACGGTGAGTGGCTGCAGATTTTGCGCAAGAACCGACAGACTGGATCAAAGTTTACGGACCCACAATTCCCGCCGGACGCGTCCTCAATTTTTCGT
GATGTCAACAATCCAAAGTACCCGCATCTACTGGAGTACGTCCGGAAGTGGAAACGTGTGACAGAATTCTTCAACGAGACGGCGTACGTTGAGATCACGA
TGCTAGATGACGCAAAGAAGCTGGTGTGCAGCATGTCTATCAAAAGCCCAGCTGAGACTGAAAGTATTCTGAGTGTGATCCGTCAGAATCCGACCCCAGT
CGATGCGCAGTTTTTGAGAACCGCCAAGGAAGCAGTGACAACGGGTGTCACGAAACGCAAGCGCGATCACTTGATGCTGCTCACGAAGAACATGATTGTG
CACATGAGCGAGTATGTGCAGGATGGACTCCAGCGCTTCGAGTTGATGTGGGAAAAAAGCTTGCTTGATCACTACAAACCGCTTGCATTTTCCAGCGTCG
GGGATGGATCGGGCTACCGTGTTGACGGATCTGAGTCCGGTGTAGTATCTCGCGTCTCCATTTTGGTGCCCGTCTACTTTCATGCGCAGGGCACGTGCCT
TTTTGACCGTTCGCGCGAGTCCAAAGCCGCCAGTCGTATCTCAGGAGTGGGTATAGGCCCTGGGGAATTGCGT