Description :
From Genome Similarity Track
Location :
scaffold_15:904790- 905951
Transcript NameFunction/comments
Plaha_PHALS_00855p-type atpase (p-atpase) superfamily
Plaha_PHALS_00856FKBP-type peptidyl-prolyl cis-trans isomerase

Sequence
1161 bases(100 bases per row)
TTCAGAGGAGTCAGCATCATCACTGGTCGATTATTAGCCACATGATCAGCGCGATGGCGCTCTCGATCCTCCAAGGCCTCTTTAATTGCACTACACACTA
GAACCACCGCTAGCGGTAACAGGATTGTAGGAATACCACTCGTGTTGCTGATTTCTTTGATAGTCTGAAGTAACGCAATGAACAGGAAATACATGTTTGA
AGGTCGCTTCACCTGTGCCAAGAGCACTCGCGGTAAGAAATTCCAGACACCATACTTCGCGCTCACCACAACATTATTGATAAAAGGCGAAGGCGGCTCC
AAGGTTTCTTCACGTGATCGCTTCGTGCCGTTAAACAGCCACGAAGACTGCCGATTGCCCAGTCGACGCTCCTCGCTTTCTTCTCGTCGACGTTGACGCT
GCGTGAGGCTTGCGCGCTCTAGAAGTTTCGTACGATCAACGTGTATCACTCGAGGACACTCGCTTGCTTCCTCCAGAGTCACACTGGTCACAAGGGGATC
TGGCATTGCCCCGGCGTTTTGCACATTGACGATTGTTTATGTCACAAATTTTATTATCAGTGATGACACTAACTTAAGTGTAACCGGTTATATCAGATGG
TGGACCGGGTCAAAAAATGGAATCATTTCTATCCATCAACACTAAAAGCTATGCCATCGCATGACTCGCCGACTTCGGCGATGAGCCTGGGAAACTCGCT
TATGTGGGAAAAAGTGGCATTGTCTCCGTTAGAAATTCAGTCTGTGCAGCTGGAGCATGATCTGCTGTACGCTCAAGAGGTGGCCGCATTGACCGCAAGT
AATCAGCAGAATAAGTACGGAGTAGATGTCGATGTCAATACTGGCAAGGCTGCAGGTCGATTGATTATAGAAGTTTTGGAAGTTAAAGGCTTGGCACTGG
ACAGTTATGCAGCGGTAAAGGCGATTAGTGGAAATACACAGCCACAAGTGTACGTGTCCACATTAGTGTCCCCGCTTTCAGCTTTCGAGAAGACAACGAA
AAAACACTTGCGTACGAGTCCTGTGCAAATTGTAAACTATGCCTGTGCACGTCTGCAGGATAAATTAGTATACAATGGAGCCAAGACAAAAATATTTAGC
GTAAAAGTTTCTCTAAATTGCAAGGCTGAAGTCATTGCTGATGTGATCCTCGGGGAGCTGG