Description :
From Genome Similarity Track
Location :
contig_43:90479- 92342
Transcript NameFunction/comments
g7816.t1KUF83987.1 Myosin protein [Phytophthora nicotianae

Sequence
1863 bases(100 bases per row)
CATACCAGAGCAACGCAGCTGGTCCACAACGTAACCATGGTCGAAAACGCCAGGCGACATCGTCGGGTTCGGCTTAATACACCGAATAAAGTTGCAGCGC
GTTGCATTTAGCGTGTCCGTCAGCTCCTGCATCTGATCGCAGAACTTGGCCGACACGCTCTGCTTGTGAAGCTGACTCAAGTTGGACGCGCCATTCATCG
AGTCCAGGTCCAGCTTCGACGAGAACAGCTCCTTAATAAGCGAGGACTTGCTAGACGTCACGAAATCTTCCAGGTCCTTGGGAATCGTATCGTTGTTCTT
GTCGATGAAGTTGCCAATCGTGTACGGCACACGCGTGGCGAAGTGCTTGACGATGAACTCGTACTTCTTGTCCTTCTCGTGAGGAGGCAGGAAGTGAGAG
TGACCCGCGTGCGTCTTGTGCAGCGTGGCATTCCACTTCTCGTCGGACGGCTTAGGCATCTTCGCTTCCTGGTCCAGCAGCGGCAGAATACCATTCGGCT
TCTGCGAAATTAAGTCGATACAGTCGCGGTTATCGGGCCACACGATCTTGCCGACCTCAATACCTTCAGCAGCGAACAGCTCCTGCTCGGCAATAAACAC
CTGCTGGTTGAATGTGGCCTGCAGGGCCTCGTTAGCGTAGTTAATCAGCAGCTGCTCAAAGTCGTTCTCCTCGAAGGACTCGAAACCGAAGATATCGAGC
ACACCGATGAACGGCAGCGAGCTATCACCGTGGCCAAGCGACGTGTTGATTCTGTACAGAATCCACTTGAACAGGTGGTTGTAGATAGACTTGGCGATAG
CGTCACGCACGTAGCTTCCCTCCTTCGCCGTGCGTTTGATCGTAAAGTTCTCCGTACGCGTCGAGATCTCGCGCGTCGTGATCACATGCAGCAGGTTGGT
GCTATCCACACCGAGCAGCTCCGCGCACGACGCCACGTACTTCTGCGCCTCCGGAGTCACCTCGCCAGCGTCGCCCTCCGCCGTCTCGCGGTCTTTCAGG
CGAATGTTACCAAGATGCAGAAGACCGGACAGGATCGTCCAAACCTGTTTCTGCAGCGCCGCGTCAATGTTCACAGATCCCAGAGCGCTCGCCACCTCGT
CGAACAGGATCTCATCGTCCACATTCGGGTCCGACACGCAGCCGCTCTGGTTCAGGTAGTCGAAGTTGTTCACCGACTCGAGCTTGAGCTCCTTCGTCAG
CGCCTGGTCCGCGCCGGACAGCAAAAAGTAGAAGATGTGGAAGTTTCGCTCGCCTGGGATTTGCGCCACCACGCGGAACTTCTCGAGCAGGTAAGTCTCA
ATGAACGCGCCAGAGAGCGTGTTGTCGCCTGGCTTGAACTGCAGCTTCATGAACTTGCCGAAGCGCGACGAGTTGTGGTTGCGCAGCGTCTTGGCATTAC
CGAAAGCTTCGAGGATGGGGTTCGTGTCCCAGAGCCGCTTGTCCAGCTCCAGCGCCAGGTCCTGCTGGGCGTCGTTGCCCTTATTGGCCGTGAAGGCCAG
GTGTTCCCGGGACGTGAGGTACCGCAGCACGATCTTGGACGTCTCGGTCTTACCGGCTCCGGATTCGCCCGAGATGACGATCGACTGGCACTGCGCGGGC
GTGCGCAGCGCCATCTGCTGGAAGGCCACCTCAGCGATCGAGTACGGGTGCGGGGGGCGGTCCCCCATCTGCGTCTTGATGTAGTCCGTGACCTTGGGCT
CCACCGTGCGCACGAGCGGGTTCACGGCGATGAGCACGTTGGCCATGAGCGTGTAGGGCCTCAGATTGTCGGCCTTGGAGCGCACGAACAGGTTCTCGAG
GATGCCGGCCTCGTGGATGTAGTACAGACTCGTCATGTCGTCCACCACGCGCGGGTTCACCTT