Description :
From Genome Similarity Track
Location :
Scaffold_68:90454- 92847
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_20987Hypothetical protein

Sequence
2393 bases(100 bases per row)
TGCACGACACATGAATAGACTTTTTGTCGCCTAACTCCTCACAGTGATACCCGAACACCAAGATCGTCAGATTATACCTCTCTTGTGTAGCATGCTCCCG
AGAATGTTTACGTCTTGGACTGTCATGGCAGGCGCTTGCTGCTGGAAGAGTTGCTTCTTGACTGCTCGGTCCGTAAACTTGCTTTTTAAGAAACTACGAA
TCTTCGTGCACCGCGCCGATTCCTTGAGGCTCGTTGCGCTGAAGTCCTTGATCATGCGGTTCTTGATCTACATACATGTACGCTGAGCAATGGTTTAGAG
AGCTAACATTTAGACCTGCGAGAGATAGTTGTCTGCAGTGCCCATCGAGAGCACGCCCTCGCTGTTCTTCGATCGCTTGGACGTGTGGTTGTAGAGGAAC
ACGACAAAGTTGTGGAGAATCGTGTAGATGTTGCGGCGTGGGAGCGCATTGCTCTCGACCTCTGCCGCTCTGGTCTTCTTCCAGTCCTCACGGACAGTGT
CCCATGTGTAGTTGGCCTCAGCCATAAAAGCGTCGAAAATCGCCGTCGCGGAACGTCTTTGGCCTAGTCAATGCGAGTTTTTTACATCCCGGCGAGTGAC
GTCATCGTACCGCGTGTGCCTGAGGGCACGTCGTCGTCGTCAATCTCTTCTCCGAGTTCTTCGCCAGGACCAAGGGACTCGGCCACTGGCGGTAGGAACC
CTGGAGACTCGACGTCCTATAGGACCTCTTGAGCAACACAGCACTCGGACGCAGTACGTACACGCACCTGGTTTGACACTTGTCTCGCCGCGTTGTTCGC
CGCATTGCTCGTCGTCGCCTTGGCAGTCGCGTTGCTCGCCGCCGCGCCGGCCGTCTTGATCCGCTTCACCAGCGTCCTTGGTGGTTCGGCCTCGTCCTCG
TACGCGTCCTCCACGGGCTGCTTTCTCTTCCCCTTCGCCATTCCTATTTCGGTCTGAGATCCTTCGAAAGATCTCCGTGGCTCCTCGCAAGATCGCCCCA
GAAGATCGATCTGTCAGGTGACAGAACGGCCATAGGGCGCCACTAAACGCCGTCTCTGTCACGAGCGTTTTTAATGCGAGTAATTGCCCGTTATATACAA
ACATCGAATGAGTATTATTCACACACACCGCGATATGACAAGAAACTTTCGAGATCGGAGCCGACGAAACGCCTAAAGTCCGTTTTCGAACTTTAAAAAG
AGGCATACCCAATTTTAGATAAGAGGCGTACTTAAATGAACATTCCTTGTTGCTGGCCAATCAGATGCACGTATTTTTTAGCCAATCATATACGTCTGTC
ACAGAGGCAATTAGACTGCTGTAAAACGACGCGCCGTGATCTGATTTTGAAATCACGTGATCTATCGTTACTCGAGTTCCATGGTTGTGTGACCGTGTGT
GGAAGCGCTCGATCAGGAGGAACGAGGTTACTTTGTTTCAATTGACTGCTTCAGCAAGGCGAGACGCTATTCCCGAGCAATCGTTTGGTGCATGTTGAAT
GAATCCATGCGGCGTGGATAGCAAGTTCCTTGGTTCGGTCACACATCCATGGAACTCTCGTAACGATGGATCACGGGATTCCAATATCAGATCACGGCGC
ATAGCATAACGTTTCCAGTATCTCGCCGCAACGTTAGCAGACAAGATGCAGTCCAGTCAGGCGTATGTGGTCGATCCTTCGTTAACGTGGGCATTTCCTC
CAAGCAAGAGTAAGGCAAATGATTCTATATTTAATTTTTATCAACCCTGCGACGATAGACCCAAGGTTTTGCTACGGCCTCACGAATGCCCTTGGATACA
CGCAATATTGTTGTATAAAACCAGACGCAATTCTAGCCTCTCTCTCGTCGATGCGGCGCTTGTAGCTGGCAATTGCACGTTGATTTCGTCGCTTGAGGGC
TCCCGATGCCGTCGTCTTCAACGTTACGAGCAATCAAAACTAACGAAAGAATCCAGTCCTACACTAATACCGCACATCTCTGTTGAACGCGTCACCAGAG
CCAGAGATTACTGGCCACGGGAGATACCGTAGTACTTAGTTGCGGAAACGGGGAAGCGACAAATCTGGGCTGATTTTCGAGGAGATTCGCCAGAGCTGGG
TACGTCAAATAAAAAAACCATCCGATTGAGTTCCCAATGGAGTTGGAGAGGTTATGGGAGAATGCCATCTTGCATCATTTTGCACCACTCCCAAGTGGCG
CAGACGGATGCATAGTCAGATCAAGTACCGGTAAACGTATTTCGATGCACATGCCCAATTTTGGTGCGGATTTGACGGCAACGGTTGGTCGCAGTGCGGG
CGGCGATGTTCCTGAGAGCATGCCAGTACAGTGTACTACTGTGCGAGTGCACTGACGCGAGGCGAATCACATAATCGATTGCTAAGGCAAGCG