Description :
From Genome Similarity Track
Location :
Scaffold_9:904336- 906686
Sequence
2350 bases(100 bases per row)
TTCTCCCCCACTTAGGACCGAAGCCCCGGTACTGCCTCGTAATGTGAGCGGCACCTGAGGGTGGCGCAACCCGTCCAGGTAAAAGGGCGTAAAGCCCGTC
GATGCATGTACCGCACTGTTGAGTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGCGCGGGGCATCTCCGCGCAGATACTGCGGAGCGTGTCTTCGA
GCACGCGATTGACGCGCTCCATCTGGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGTCGTGTGCCGAGAAGGCGAAACAGCGTCTGCCAGAA
CGTAGCGGTGAACCGCGGGTCTCGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCA
GTGACGGTGTCACGAACTGGAGCAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCAGCCGGAAGTCCGA
AGACAAAGTCGAGACTCATCGACTTCCAGCAGTCCGCTGGGACCGGCAGGCTATGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACACGCTGGCACGT
CTCGCACGTACGGACGTAGGAGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTCTTCTCACGGCCGAGATGGCCA
CTGGATGGAGCGTCGTGCGCCTCCATCAGGATGTCGTACTTGAGATCCTCGTCGTTGGGCGCGACAATACGGGGAGGATCCTCCGGCTCGACCCTATAGT
GGAGCAAACCGTCAGCCCACTCATAGCGGTGCAGCCTTGCACGTTGTCGGGGCGTGAGCCACTCGGCCTTGGCTTCCGAGCCAGCGGCCAAGAACCACAC
AAGAGGTCCGAGACTGGCATCGTCTCGGTACCCCAGCCTGATGCGATCATACAGATCCGTCGTGACCCGATTAATATGAGCAAGCTCGTAGTCGGGTCGG
CGCGACAGCGCGTCGGCAAGCACGTTCAACTTGCCCGGCTTGTACTCGACACGGAAGTTGTATTCCGCGAAGAATGACAGCCAACGCATCATCCGCTGTG
AGAGATGCGGCGTGTTGATGGCAGTCCGCGAGGACGCGTGGTCTGTATAAACGACAAAGGGCGTCGAGCCCAGGAGGTGCACTCGGAACTTGACAAGAGC
GTACTTCATGGCAAGTAGCTCCTTGTCGTGGACTGGATAGTTCCGTTCGGCTGCCTTGAGCTGCCTGGACTGGAACGAGATGACCCGTTCGCGGCCTTCA
TCGTCGGCCTGCAATAGCGCACAGCCAATTGCGTAGTCAGACTACGCTGAAAGGCTTCGTCTCGTCCGGCAATGCCAGGACTGGCGCGCGCTGTAAGCTC
GCTTTGATGTCGTTAAAAGCATCTTGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGACAAGGGCCGTGCCAGCTCGGCGTAGC
CTGCACTATACTTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTAGTACGTCCTTCTGCGACCGACGTGGCGGCCAAGCCGCGATGGTTTTCACCTTCTC
CGGGTCCGCCCGGACCCCGGCGCTGCTGACGAAGCAGCCCAGGACCTTGATCACCTCAGCCGCGAACACACACTTGTCGATGTTGGCGTACAGCTTGTTC
GCCCGCATGACTTCGAACACACGTCGAAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGGCACGGCTGTGGACGAAGATGCCGTCAAAGT
ACATCTGTGTGAACGCACGCAAAGGTCGGAACAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGCCCCTGAGGCATGACCAGCCACTC
CCAGAGCATACCGCTCGGCGTGCTCACAGCCGTGAGTGGGATGTCGCTCTGGCGCATCAGGATCTGGTAGTATCCGTCCACCAGGTCCAGCGCGCTATAC
AGCGTGCAGCCGGCCATGTTGTTGAGCAACACGTCCTTGCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCTGTTCAGCTTGTAATAAGCATGAACCA
GACGTCACTTTCCGTTCGGTTTGCGAAAACAGAAGGTAAGCGTCGAGTGCGGGGACTTCGACTCCCGCACCATGCCTGCCTTCGCCTTGGCGGCAAAGAA
GGCATCAATGACTTCACACTGCTCCCGGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCGATCTCGTGCCTGATTCCCCTG
TCCGGAGGGAGATTGGACGGTGGATCCTTGGACACCACGTCCTCGAACTC