Description :
From Genome Similarity Track
Location :
Scaffold_383:9043- 11161
Transcript NameFunction/comments
Hyaar_Emoy2813964glycoside hydrolase, putative

Sequence
2118 bases(100 bases per row)
AGACAAGAAGGCAACTAAATCCCATCAAAGCTCGAGACAGTACGATCGAGATCAGAAAGCATCCAATATATCTTCGTCAAGCTTCATTGATTGAACAGTT
AATCAAGGTCAACCAAATGCTCGAATCTCACGTCTCGATGATTGAAGCTGAGGTTTACAAAAAAGCACAGCCAAAAACTACACATGAAAGAAGTGAGGAT
AAAAGCAAAGAAACACCAGCCAAACGTCGCCGAACGAGTTCGTCAACAAACCTGAAGGACGTCTAGTTCTCCTGGTATACCCCGGAACCCCGCCTCTGGG
GTTCGTTTGATAGCTCGAGCACAAGAAATCCACCGCCAAACTTGTCGCTGCATTCATGAAGCTGTTTCGTGCTAATGGCTTCGTGCTTAGCTCGTCCGGA
CTCTCATGATACAGCGTATATACAGGATAGTACAATAATCCATTTCACCCTTAAGCGTCGGTGTCAGCTCGCTCAAATTGTTCTTGGACATGACAGCATC
GTATCACGTGCCGGCGTGTAATTGCCCTGCTAGAAGGTCGAGCTCTCCGTCATCGTGTACACTTTTTTCCGGTTATTATACATCATGTACGGATTGAACT
CGCACATGGTCGTCTTATTGTCTCTGTTGTCCGACTGGAAGTATCCAACACCGTTCTTGCTTGCGACGCCAGTCGTGGTCAGAGCTACAAGCACGCATCA
ATACTCAATGATTAGAGCCGATCTTCCGACCGATCACATGCATATTCACCACTTTAAAGCTTACTCTTGGTTTCAACGAAGTTGGCGACTTCTGTGGTCT
ACCCAAACACGTTGCCACCCACGATCTCGTAGGTCACCCCTTCTCCTTGATCATTCAATTGGCCTACACGCACGAAACAGGATCGTTGTCACCTTTGTTA
AATTCACAACATTTTACACTCTCCCTCTTCTCGCTCCTTACATTGTACAACATGCGCTGGTTCCCGTAGCAGTCACTATTTTTCACGCCTTGTCGCAAAC
AAACTCTCTACACATGGTCGGACGAGAATAGCCGACCTTCGCGTACTCTGACATGACCTTCTTCGGCCCGGAAGGATGCGAGTACTTGACGTGGGTCGTT
GGATCGCACTCGACGTACGGGTTGAAGCCCATCCTTTTCACGCAGCCACAAAAAGAACATCAAACATAGTGAGCAACCTGCCACCCACCCATCCACCCAT
CTACCGCACTACATCCACTGCAGTCACAGCATCCGCTGAAAAGGCTCCATCAACCATTAACTCGTCATACGTACAGCACGCGTAGTCTCATCTTCGTCTA
CCTAACAATGGTAGTATATGCCATCCACTGCTTGCGGAGCGGAATGTCAGCAATGTCGAGACCGAAGGACACCTGACTCACAGACCCCGAGCAGCTAGCA
GCTTAACCACGTGTGTCACGTAATACCATCACTGATGCCTAGCGTTTTGTCGAACACAGCAACCGCGCTGTACACCATTTACGCACGGGAAACGGGTTAT
CGGGATATCACATGGGCGGCAGGTAGTCTAACATGTAGCTGCTTACCTGTCATTGAATACAACATAACGATCAAGTCGCAGTCAAGTACGTGCGTATGGA
TATACATGGACACGGGTGCACGTACGTATACATTGAAGCACCATCATGTATAACTCGTCCACAATCCACATGTCGTGGTAGATTAACACGTTGGCACAAC
TCGCGATGAAGTGAATCAGATCAGTACGTATAACACTGCTTTCGAGCACGCACACATGGGACAATTCAATTTGCCTCAATGAATCATATTTCAAGCTCCC
CTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN